nusG:Gene: Difference between revisions
Fixing Gbrowse links (bug #119) |
Data loaded by TableEdit_Loader. |
||
| Line 288: | Line 288: | ||
est. P1 cotransduction: 51% <ref name='LIB:Nichols_linked_Tn'/> <br /> | est. P1 cotransduction: 51% <ref name='LIB:Nichols_linked_Tn'/> <br /> | ||
Synonyms:thi-39::Tn10 | Synonyms:thi-39::Tn10 | ||
|- | |||
| | |||
[[:Category:Kohara_Phage:E11C11|E11C11]] | |||
| | |||
Kohara Phage | |||
| | |||
[http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=534 Genobase] | |||
| | |||
PMID:3038334 | |||
|- class="tableEdit_footer" | |- class="tableEdit_footer" | ||
Revision as of 21:23, 2 September 2011
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
nusG |
|---|---|
| Mnemonic |
N (phage lambda protein) utilization substance |
| Synonyms |
ECK3973, b3982, JW3945[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
90 minutes |
MG1655: 4175766..4176311 |
||
|
NC_012967: 4157354..4157899 |
||||
|
NC_012759: 4065446..4065991 |
||||
|
W3110 |
|
W3110: 3458938..3458393 |
||
|
DH10B: 4275462..4276007 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
4175769 |
Edman degradation |
| ||
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
| edit table |
Notes
Genetic Interactions
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3945 |
Plasmid clone |
Status:Clone OK Primer 1:GCCTCTGAAGCTCCTAAAAAGCG Primer 2:CCGGCTTTTTCAACCTGGCTGAA | |
|
Linked marker |
est. P1 cotransduction: 42% [6] | ||
|
Linked marker |
est. P1 cotransduction: 51% [6] | ||
|
Kohara Phage |
|||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Wilkins, MR et al. (1998) Protein identification with N and C-terminal sequence tags in proteome projects. J. Mol. Biol. 278 599-608 PubMed
- ↑ Tonella, L et al. (1998) '98 Escherichia coli SWISS-2DPAGE database update. Electrophoresis 19 1960-71 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 5.0 5.1 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed