parC:Gene: Difference between revisions
Data loaded by TableEdit_Loader. |
Appended "[[Category..." using batch script. |
||
| Line 322: | Line 322: | ||
[[Category:Genes in the Keio knockout collection]] | [[Category:Genes in the Keio knockout collection]] | ||
[[Category:Genes in the ASKA clone collection]] | [[Category:Genes in the ASKA clone collection]] | ||
[[Category:par genes]] | |||
Revision as of 00:39, 25 September 2008
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
| Standard name |
parC | |
|---|---|---|
| Mnemonic |
partitioning of the nucleoid | |
| Synonyms |
ECK3010, b3019, JW2987[1] | |
| edit table | ||
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Notes
The partitioning defect comes from the inability of these cells to partition the nucleoids into daughter cells. This leads to filamented cells with a cluster of DNA and other DNA- free cells
Location(s) and DNA Sequence
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
68.15 minutes |
MG1655: 3163995..3161737 |
||
|
W3110 |
|
W3110: 3164629..3162371 |
||
| edit table |
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Notes
Sequence Features
| Feature type | Location | Description |
|---|---|---|
| edit table |
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Notes
Alleles and Phenotypes
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
parC1215 |
Growth Phenotype |
ts @ 42 |
| ||||
| edit table |
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Notes
The Keio collection[4] lists a deletion of parC, which is an essential gene. The insertion in this strain probably traps a duplication of the parC region.
Genetic Resources
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2987 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAGCGATATGGCAGAGCGCCT Primer 2:CCtTCTTCGCTATCACCGCTGCT | |
|
Linked marker |
est. P1 cotransduction: 67% [7] | ||
|
Linked marker |
est. P1 cotransduction: 56% [7] | ||
| edit table |
See Help:Gene_resources for help entering information into the Genetic Resources table.
Notes
Accessions in Other Databases
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
See Help:Links_table for how to enter or edit information in this section of EcoliWiki.
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Kato, J et al. (1990) New topoisomerase essential for chromosome segregation in E. coli. Cell 63 393-404 PubMed
- ↑ Kato, J et al. (1988) Gene organization in the region containing a new gene involved in chromosome partition in Escherichia coli. J. Bacteriol. 170 3967-77 PubMed
- ↑ Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 6.0 6.1 CGSC: The Coli Genetics Stock Center
- ↑ 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).