yhjA:On One Page

From EcoliWiki
Jump to: navigation, search

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Quickview | Gene | Product(s) | Expression| Evolution | References |

Quickview

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

<protect>

Standard Name

yhjA

Gene Synonym(s)

ECK3503, b3518, JW3486[1], JW3486

Product Desc.

predicted cytochrome C peroxidase[2][3]

Probable cytochrome c peroxidase; mutants are sensitive to peroxide during anaerobic growth[4]

Product Synonyms(s)

predicted cytochrome C peroxidase[1], B3518[2][1], YhjA[2][1] , ECK3503, JW3486, b3518

Function from GO

<GO_nr />

Knock-Out Phenotype
Regulation/Expression

transcription unit(s): yhjA[2]

Regulation/Activity
Quick Links

porteco.png EcoCyc.gif regulondb.jpg

dnadisplay.png proteindisplay.png   pubmed.jpg   textpresso.jpg  

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]


FNR regulon. OxyR regulon.[4]



Gene

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

yhjA

Mnemonic

Systematic nomenclature

Synonyms

ECK3503, b3518, JW3486[1], JW3486

</protect>

Notes

Location(s) and DNA Sequence

[back to top]


<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

79.01 minutes, 79.01 minutes 

MG1655: 3667211..3665814
<gbrowseImage> name=NC_000913:3665814..3667211 source=MG1655 preset=GeneLocation </gbrowseImage>

REL606

NC_012967: 3598679..3597282
<gbrowseImage> name=NC_012967:3597282..3598679 source=REL606 preset=GeneLocation </gbrowseImage>

BW2952

NC_012759: 3554308..3555705
<gbrowseImage> name=NC_012759:3554308..3555705 source=BW2952 preset=GeneLocation </gbrowseImage>

W3110

 

W3110: 3971227..3972624
<gbrowseImage> name=NC_007779:3971227..3972624 source=W3110 preset=GeneLocation </gbrowseImage>

DH10B

DH10B: 3764956..3763559
<gbrowseImage> name=NC_010473:3763559..3764956 source=DH10B preset=GeneLocation </gbrowseImage>

</protect>

Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

<protect></protect>

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔyhjA (Keio:JW3486)

deletion

deletion

PMID:16738554

Shigen
CGSC10582[5]

yhjA::Tn5KAN-I-SceI (FB21253)

Insertion at nt 402 in Minus orientation

PMID:15262929

E. coli Genome Project:FB21253

contains pKD46

ΔyhjA773::kan

PMID:16738554

CGSC:105254


<protect></protect>

Notes

Genetic Interactions

[back to top]


<protect>

Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

</protect>

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW3486

Plasmid clone

Shigen

PMID:16769691

Status:Clone OK

Primer 1:GCCAAAATGGTCTCACGTATTAC

Primer 2:CCTTGTTTATCCTGCATATACGG

9G3

Kohara Phage

Genobase

PMID:3038334

zhg-50::Tn10

Linked marker

CAG18450 = CGSC7450[5]

est. P1 cotransduction: 1% [6]
Synonyms:zhf-50::Tn10, zhf-5::Tn10

zic-4901::Tn10

Linked marker

CAG18492 = CGSC7457[5]

est. P1 cotransduction: % [6]

<protect></protect>

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG12244

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG12244

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120002127

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:948038

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB2155

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0011493

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



Product(s)

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name

YhjA

Synonyms

predicted cytochrome C peroxidase[1], B3518[2][1], YhjA[2][1] , ECK3503, JW3486, b3518

Product description

predicted cytochrome C peroxidase[2][3]

Probable cytochrome c peroxidase; mutants are sensitive to peroxide during anaerobic growth[4]

EC number (for enzymes)


<protect></protect>

Notes

Function

[back to top]


<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier GO ID GO term name Reference Evidence Code with/from Aspect Notes Status

GO:0004130

cytochrome-c peroxidase activity

GOA:spec
GO_REF:0000003

IEA: Inferred from Electronic Annotation

EC:1.11.1.5

F

Seeded from EcoCyc (v14.0)

complete

GO:0004601

peroxidase activity

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0575

F

Seeded from EcoCyc (v14.0)

complete

GO:0005506

iron ion binding

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR003088

F

Seeded from EcoCyc (v14.0)

complete

GO:0005506

iron ion binding

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR009056

F

Seeded from EcoCyc (v14.0)

complete

GO:0005506

iron ion binding

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0408

F

Seeded from EcoCyc (v14.0)

complete

GO:0006810

transport

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0813

P

Seeded from EcoCyc (v14.0)

complete

GO:0009055

electron carrier activity

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR003088

F

Seeded from EcoCyc (v14.0)

complete

GO:0009055

electron carrier activity

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR009056

F

Seeded from EcoCyc (v14.0)

complete

GO:0016491

oxidoreductase activity

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR004852

F

Seeded from EcoCyc (v14.0)

complete

GO:0016491

oxidoreductase activity

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0560

F

Seeded from EcoCyc (v14.0)

complete

GO:0020037

heme binding

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR003088

F

Seeded from EcoCyc (v14.0)

complete

GO:0020037

heme binding

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR009056

F

Seeded from EcoCyc (v14.0)

complete

GO:0022900

electron transport chain

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0249

P

Seeded from EcoCyc (v14.0)

complete

GO:0046872

metal ion binding

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0479

F

Seeded from EcoCyc (v14.0)

complete

GO:0055114

oxidation reduction

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR004852

P

Seeded from EcoCyc (v14.0)

complete

GO:0055114

oxidation reduction

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0560

P

Seeded from EcoCyc (v14.0)

complete

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type Partner Notes References Evidence

</protect>

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment Description Evidence Reference/Source Notes

<protect></protect>

Notes

Structure and Physical Properties

[back to top]


<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence

at EcoCyc

MKMVSRITAI GLAGVAICYL GLSGYVWYHD NKRSKQADVQ ASAVSENNKV LGFLREKGCD
YCHTPSAELP AYYYIPGAKQ LMDYDIKLGY KSFNLEAVRA ALLADKPVSQ SDLNKIEWVM
QYETMPPTRY TALHWAGKVS DEERAEILAW IAKQRAEYYA SNDTAPEHRN EPVQPIPQKL
PTDAQKVALG FALYHDPRLS ADSTISCAHC HALNAGGVDG RKTSIGVGGA VGPINAPTVF
NSVFNVEQFW DGRAATLQDQ AGGPPLNPIE MASKSWDEII AKLEKDPQLK TQFLEVYPQG
FSGENITDAI AEFEKTLITP DSPFDKWLRG DENALTAQQK KGYQLFKDNK CATCHGGIIL
GGRSFEPLGL KKDFNFGEIT AADIGRMNVT KEERDKLRQK VPGLRNVALT APYFHRGDVP
TLDGAVKLML RYQVGKELPQ EDVDDIVAFL HSLNGVYTPY MQDKQ
Length

465

Mol. Wt

51.571 kDa

pI

6.4 (calculated)

Extinction coefficient

68,300 - 69,175 (calc based on 20 Y, 7 W, and 7 C residues)


Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type Residues Description Notes References

Domain

183..335

PF03150 Di-haem cytochrome c peroxidase

PMID:19920124

Domain

339..454

PF00034 Cytochrome c

PMID:19920124

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=yhjA taxon=562,83333 </beststructure>

Models

View models at:

</protect>

Structure figures

<protect>

</protect>

Notes

Gene Product Resources

[back to top]


See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type Source Notes/Reference

<protect></protect>

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

NCBI (Protein) (EcoliWiki Page)

GI:16131390

Escherichia coli str. K-12 substr. MG1655

NCBI (Protein) (EcoliWiki Page)

GeneID:948038

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0011493

Escherichia coli str. K-12 substr. MG1655

UniProt (EcoliWiki Page)

UniProtKB/Swiss-Prot:P37197

Escherichia coli str. K-12 substr. MG1655

EcoCyc

EcoCyc:EG12244

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG12244

Escherichia coli str. K-12 substr. MG1655

NCBI (Gene) (EcoliWiki Page)

GeneID:948038

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120002127

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB2155

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]




Expression

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.


Cellular Levels

[back to top]


See Help:Cellular levels

Molecule Organism or Strain Value Units Experimental Conditions Assay used Notes Reference(s)

Protein

E. coli K-12 MG1655

9

molecules/cell/generation

  • Medium: MOPS Complete
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

4

molecules/cell/generation

  • Medium: MOPS Minimal
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

0a

molecules/cell/generation

  • Medium: MOPS Complete without Methionine
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

Low confidence in the sequencing data set.

PMID: 24766808

Notes

Transcription of yhjA is ~30-fold higher during anaerobic growth than during aerobic growth.[7] Anaerobic induction is controlled by Fnr and OxyR.[7]

Transcription and Transcriptional Regulation

[back to top]


<protect>

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)

yhjA

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]


<protect><gbrowseImage> name=NC_000913:3667191..3667231 source=MG1655 flip=1 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]


<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name Mutation Phenotype Reference

del(tyrR-fnr-rac-trg)17

deletion

Mutation prevents anaerobic induction of yhjA-lacZ operon fusion

PMID:17464064

oxyR(del)::kan

deletion-replacement

Mutation prevents anaerobic induction of yhjA-lacZ operon fusion

PMID:17464064

FNR-binding site altered from TTGAT-N4-ATCAA to ATCAT-N4-ATGAT

Mutation of the FNR binding site essentially abolished FNR-mediated regulation of a chromosomal PyhjA-lacZ operon fusion (Table 3).

PMID:17464064

OxyR-binding site altered from ATAGgcacaggCTATcttattgATAGtTtatAttcAT to TATCgcacaggGATActtattgTATCtAtatTttcTA

Mutation of the OxyR binding site essentially abolished OxyR-mediated regulation of a chromosomal PyhjA-lacZ operon fusion (Table 3).

PMID:17464064


Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type Reference Notes

microarray

GEO Profiles:b3518 (EcoliWiki Page)

NCBI GEO profiles for yhjA

microarray

GenExpDB:b3518 (EcoliWiki Page)

Summary of data for yhjA from multiple microarray studies

reporter genes

PMID:17464064

lambdaRZ5(PyhjA-lacZ) chromosomal operon fusion


Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name Resource Type Description Source Notes

<protect></protect>

Notes

Accessions Related to yhjA Expression

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG12244

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB2155

Escherichia coli str. K-12 substr. MG1655

EcoliGenExpDB (EcoliWiki Page)

EcoliGenExpDB:b3518

EcoGene

EcoGene:EG12244

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120002127

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0011493

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



Evolution

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]


See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism Homologs (Statistics) Comments

Xenopus tropicalis

  • ENSXETP00000001385 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Shigella flexneri

YHJA

From SHIGELLACYC

E. coli O157

YHJA

From ECOO157CYC


Do-It-Yourself Web Tools

<protect></protect>

Notes

Families

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

Pfam (EcoliWiki Page)

PF03150 Di-haem cytochrome c peroxidase

Pfam (EcoliWiki Page)

PF00034 Cytochrome c

Superfamily (EcoliWiki Page)

SUPERFAMILY:46626

Superfamily (EcoliWiki Page)

SUPERFAMILY:46626

EcoCyc

EcoCyc:EG12244

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG12244

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120002127

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB2155

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0011493

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. 2.0 2.1 2.2 2.3 2.4 2.5 2.6 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  3. 3.0 3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  4. 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
  5. 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
  6. 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
  7. 7.0 7.1 Partridge, JD et al. (2007) The Escherichia coli yhjA gene, encoding a predicted cytochrome c peroxidase, is regulated by FNR and OxyR. Microbiology (Reading, Engl.) 153 1499-507 PubMed

Categories

[back to top]