yciG:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
| Standard Name |
yciG |
|---|---|
| Gene Synonym(s) |
ECK1253, b1259, JW1251[1], JW1251 |
| Product Desc. | |
| Product Synonyms(s) |
predicted protein[1], B1259[2][1], YciG[2][1] , ECK1253, JW1251, b1259 |
| Function from GO |
<GO_nr /> |
| Knock-Out Phenotype | |
| Regulation/Expression | |
| Regulation/Activity | |
| Quick Links | |
| edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
ymdF and yciG are paralogs. YciG and YmdF may be related to small stress proteins (shares COG3729 with GsiB of B. subtilis).[5] yciG is regulated by RpoS.[6]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
yciG |
|---|---|
| Mnemonic |
Systematic nomenclature |
| Synonyms |
ECK1253, b1259, JW1251[1], JW1251 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
28.32 minutes |
MG1655: 1314059..1313880 |
||
|
NC_012967: 1313629..1313450 |
||||
|
NC_012759: 1204729..1204908 |
||||
|
W3110 |
|
W3110: 1317749..1317570 |
||
|
DH10B: 1403455..1403276 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔyciG (Keio:JW1251) |
deletion |
deletion |
PMID:16738554 |
||||
|
ΔyciG::kan |
deletion |
Biolog:respiration |
unable to respire a-Ketoglutarate |
PMID:16095938 |
|||
|
ΔyciG767::kan |
PMID:16738554 |
| |||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW1251 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCGCCGAACATCGTGGTGGTTC Primer 2:CCGGATTTGCCTGATTTATTACC | |
|
Kohara Phage |
PMID:3038334 | ||
|
Linked marker |
est. P1 cotransduction: 71% [8] | ||
|
Linked marker |
est. P1 cotransduction: 88% [8] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG11127 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG11127 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120001111 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EchoBASE:EB1117 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0004229 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
YciG |
|---|---|
| Synonyms |
predicted protein[1], B1259[2][1], YciG[2][1] , ECK1253, JW1251, b1259 |
| Product description | |
| EC number (for enzymes) |
|
| edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
|
GO:0071978 |
bacterial-type flagellum-dependent swarming motility |
PMID:17122336 |
IMP: Inferred from Mutant Phenotype |
P |
Supplemental Table S1 no significant defects in swimming motility |
complete | ||
| edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
|
Protein |
yciH |
PMID:16606699 |
Experiment(s):EBI-1139338 | |
|
Protein |
pepD |
PMID:16606699 |
Experiment(s):EBI-1139338 | |
|
Protein |
rpsI |
PMID:16606699 |
Experiment(s):EBI-1139338 | |
|
Protein |
nadE |
PMID:16606699 |
Experiment(s):EBI-1139338 | |
| edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Reference/Source | Notes |
|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Name | |
|---|---|
| Sequence |
MSTHNTHINE TMQRNGRNNM AEHRGGSGNF AEDREKASDA GRKGGQHSGG NFKNDPQRAS EAGKKGGQQS GGNKSGKS |
| Length |
78 |
| Mol. Wt |
8.239 kDa |
| pI |
12.3 (calculated) |
| Extinction coefficient |
0 (calc based on 0 Y, 0 W, and 0 C residues) |
| edit table |
Domains/Motifs/Modification Sites
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
|
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
ASAP:ABE-0004229 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EcoCyc:EG11127 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG11127 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
RegulonDB:ECK120001111 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB1117 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|
|
Protein |
E. coli K-12 MG1655 |
2a |
molecules/cell/generation |
|
Ribosome Profiling |
Low confidence in the sequencing data set. |
PMID: 24766808 |
|
Protein |
E. coli K-12 MG1655 |
519 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
0a |
molecules/cell/generation |
|
Ribosome Profiling |
Low confidence in the sequencing data set. |
PMID: 24766808 |
| edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
Figure courtesy of RegulonDB |
</protect>
Notes
yciG is regulated by RpoS.[6]
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:1314039..1314079
source=MG1655
flip=1
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for yciG | |
|
microarray |
Summary of data for yciG from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
|
GFP Fusion |
Intergenic region (1314045..1314476) fused to gfpmut2. |
GFP fusion described in Zaslaver, et al. | ||
| edit table |
<protect></protect>
Notes
Accessions Related to yciG Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG11127 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB1117 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG11127 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120001111 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0004229 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Shigella flexneri |
YCIG |
From SHIGELLACYC |
|
E. coli O157 |
YCIG |
From ECOO157CYC |
| edit table |
<protect></protect>
Notes
Families
<protect>
See Help:Evolution_families for help entering or editing information in this section of EcoliWiki.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
</protect> <protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 Inoue, T et al. (2007) Genome-wide screening of genes required for swarming motility in Escherichia coli K-12. J. Bacteriol. 189 950-7 PubMed
- ↑ 5.0 5.1 5.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 6.0 6.1 Van Dyk, TK et al. (1998) Constricted flux through the branched-chain amino acid biosynthetic enzyme acetolactate synthase triggers elevated expression of genes regulated by rpoS and internal acidification. J. Bacteriol. 180 785-92 PubMed
- ↑ 7.0 7.1 7.2 CGSC: The Coli Genetics Stock Center
- ↑ 8.0 8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed
Categories


