ybhA:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Standard Name |
ybhA |
---|---|
Gene Synonym(s) |
ECK0755, b0766, JW0749, modD[1], modD |
Product Desc. |
Pyridoxal phosphate (PLP) phosphatase; phosphoramidase; physiological role unknown; HAD14[4] |
Product Synonyms(s) |
predicted hydrolase[1], YbhA[2][1], B0766[2][1], fructose 1,6-bisphosphatase III[2][1] , ECK0755, JW0749, modD, b0766 |
Function from GO |
<GO_nr /> |
Knock-Out Phenotype | |
Regulation/Expression | |
Regulation/Activity | |
Quick Links | |
edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
HAD superfamily. In vitro activities demonstrated by Kuznetsova et al. (2005, 2006). ybhA is a non-essential gene.[4]
HAD refers to the haloacid dehalogenase-like (HAD) family of proteins.[5].
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
ybhA |
---|---|
Mnemonic |
Systematic nomenclature |
Synonyms |
ECK0755, b0766, JW0749, modD[1], modD |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
17.17 minutes |
MG1655: 797654..796836 |
||
NC_012967: 779060..778242 |
||||
NC_012759: 699804..700622 |
||||
W3110 |
|
W3110: 798853..798035 |
||
DH10B: 851582..850764 |
||||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
ΔybhA (Keio:JW0749) |
deletion |
deletion |
PMID:16738554 |
||||
ΔybhA::kan |
deletion |
Biolog:respiration |
unable to respire Acetate |
PMID:16095938 |
|||
ΔybhA738::kan |
PMID:16738554 |
| |||||
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW0749 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCACCACACGCGTGATTGCTCT Primer 2:CCAATCAGGTGGCTATAAATGAA | |
Kohara Phage |
PMID:3038334 | ||
Linked marker |
est. P1 cotransduction: 54% [7] | ||
zbh-29::Tn10 |
Linked marker |
est. P1 cotransduction: 40% [7] | |
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG11239 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG11239 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120001217 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EchoBASE:EB1221 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0002607 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
Standard name |
YbhA |
---|---|
Synonyms |
predicted hydrolase[1], YbhA[2][1], B0766[2][1], fructose 1,6-bisphosphatase III[2][1] , ECK0755, JW0749, modD, b0766 |
Product description |
Pyridoxal phosphate (PLP) phosphatase; phosphoramidase; physiological role unknown; HAD14[4] |
EC number (for enzymes) |
|
edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
---|---|---|---|---|---|---|---|---|
Under review |
GO:0042132 |
fructose 1,6-bisphosphate 1-phosphatase activity |
PMID:16990279 |
F |
YbhA releases phosphate from fructose-1,6-bis-phosphate, but which phosphate is released wasn't determined. |
Missing: evidence | ||
GO:0000287 |
magnesium ion binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0460 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0000287 |
magnesium ion binding |
PMID:16990279 |
IDA: Inferred from Direct Assay |
F |
Seeded from EcoCyc (v14.0) |
complete | ||
GO:0003824 |
catalytic activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR005834 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0003824 |
catalytic activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR006379 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005524 |
ATP binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001757 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006754 |
ATP biosynthetic process |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001757 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0050308 |
sugar-phosphatase activity |
PMID:16990279 |
IDA: Inferred from Direct Assay |
F |
complete | |||
GO:0008152 |
metabolic process |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000150 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0008152 |
metabolic process |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR005834 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0008152 |
metabolic process |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR006379 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0015662 |
ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001757 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016020 |
membrane |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001757 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016773 |
phosphotransferase activity, alcohol group as acceptor |
PMID:16889420 |
IDA: Inferred from Direct Assay |
F |
Seeded from EcoCyc (v14.0) |
complete | ||
GO:0016787 |
hydrolase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000150 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016787 |
hydrolase activity |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0378 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0033883 |
pyridoxal phosphatase activity |
PMID:16990279 |
IDA: Inferred from Direct Assay |
F |
Seeded from EcoCyc (v14.0) |
complete | ||
GO:0050308 |
sugar-phosphatase activity |
PMID:16889420 |
IDA: Inferred from Direct Assay |
F |
complete | |||
GO:0016773 |
phosphotransferase activity, alcohol group as acceptor |
PMID:16889420 |
IDA: Inferred from Direct Assay |
F |
Purified YbhA will form glycerol phosphate from glycerol and inorganic phosphate (Table 4). The authors note that the phosphotransferase activity is lower than the phosphatase activity, and that other mono-phosphates can serve as the phosphate donor. |
complete | ||
GO:0033883 |
pyridoxal phosphatase activity |
PMID:16990279 |
IDA: Inferred from Direct Assay |
F |
Figure 1 and Table 2. |
complete | ||
GO:0016791 |
phosphatase activity |
PMID:16990279 |
IDA: Inferred from Direct Assay |
F |
YbhA had phosphatase activity on 8 of the 80 phosphorylated compounds tested. These were (in decreasing order of activity): pyridoxal-5-P, erythrose-4-P, Fructose-1,6-bis-P, flavin mononucleotide (FMN), thiamine pyrophosphate, phosphoribosyl pyrophosphate (PRPP), Glucose-1,6-di-P, and 6-phosphogluconate (Fig. 1). |
complete | ||
GO:0000287 |
magnesium ion binding |
PMID:16990279 |
IDA: Inferred from Direct Assay |
F |
Km is 0.14±0.02 mM with pyridoxal-5-phosphate as the substrate (Suppl. Table 2). |
complete | ||
edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
Partner Type | Partner | Notes | References | Evidence |
---|---|---|---|---|
Protein |
groL |
PMID:16606699 |
Experiment(s):EBI-1137896 | |
Protein |
moaA |
PMID:16606699 |
Experiment(s):EBI-1137896 | |
edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
Compartment | Description | Evidence | Reference/Source | Notes |
---|---|---|---|---|
edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
Name | |
---|---|
Sequence |
MTTRVIALDL DGTLLTPKKT LLPSSIEALA RAREAGYQLI IVTGRHHVAI HPFYQALALD TPAICCNGTY LYDYHAKTVL EADPMPVIKA LQLIEMLNEH HIHGLMYVDD AMVYEHPTGH VIRTSNWAQT LPPEQRPTFT QVASLAETAQ QVNAVWKFAL THDDLPQLQH FGKHVEHELG LECEWSWHDQ VDIARGGNSK GKRLTKWVEA QGWSMENVVA FGDNFNDISM LEAAGTGVAM GNADDAVKAR ANIVIGDNTT DSIAQFIYSH LI |
Length |
272 |
Mol. Wt |
30.2 kDa |
pI |
5.8 (calculated) |
Extinction coefficient |
44,920 - 45,295 (calc based on 8 Y, 6 W, and 3 C residues) |
edit table |
Domains/Motifs/Modification Sites
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
Resource type | Source | Notes/Reference |
---|---|---|
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
ASAP:ABE-0002607 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EcoCyc:EG11239 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG11239 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
RegulonDB:ECK120001217 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EchoBASE:EB1221 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
---|---|---|---|---|---|---|---|
Protein |
E. coli K-12 MC4100 |
3.92E+02 |
molecules/cell |
|
emPAI |
PMID:18304323 | |
Protein |
E. coli K-12 MG1655 |
1680 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
453 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
715 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:797634..797674
source=MG1655
flip=1
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
Allele Name | Mutation | Phenotype | Reference |
---|---|---|---|
edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
Type | Reference | Notes |
---|---|---|
microarray |
NCBI GEO profiles for ybhA | |
microarray |
Summary of data for ybhA from multiple microarray studies | |
edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
Resource Name | Resource Type | Description | Source | Notes |
---|---|---|---|---|
GFP Fusion |
Intergenic region (797579..797888) fused to gfpmut2. |
GFP fusion described in Zaslaver, et al. | ||
edit table |
<protect></protect>
Notes
Accessions Related to ybhA Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG11239 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB1221 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG11239 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120001217 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0002607 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
Organism | Homologs (Statistics) | Comments |
---|---|---|
Shigella flexneri |
YBHA |
From SHIGELLACYC |
E. coli O157 |
YBHA |
From ECOO157CYC |
edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG11239 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG11239 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120001217 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB1221 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0002607 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 1.9 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ Koonin, EV & Tatusov, RL (1994) Computer analysis of bacterial haloacid dehalogenases defines a large superfamily of hydrolases with diverse specificity. Application of an iterative approach to database search. J. Mol. Biol. 244 125-32 PubMed
- ↑ 6.0 6.1 6.2 CGSC: The Coli Genetics Stock Center
- ↑ 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed
Categories