ybcJ:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Standard Name |
ybcJ |
---|---|
Gene Synonym(s) |
ECK0521, b0528, JW5070[1], JW5070 |
Product Desc. |
putative RNA-binding protein[2]; predicted RNA-binding protein[3] Ribosome-associated protein, function unknown; putative RNA binding protein[4] |
Product Synonyms(s) |
predicted RNA-binding protein[1], YbcJ[2][1], B0528[2][1] , ECK0521, JW5070, b0528 |
Function from GO |
<GO_nr /> |
Knock-Out Phenotype | |
Regulation/Expression | |
Regulation/Activity | |
Quick Links | |
edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
Ribosome-associated protein (Jiang, 2007).[4]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
ybcJ |
---|---|
Mnemonic |
Systematic nomenclature |
Synonyms |
ECK0521, b0528, JW5070[1], JW5070 |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
11.98 minutes |
MG1655: 556096..555884 |
||
NC_012967: 528981..528769 |
||||
NC_012759: 458644..458856 |
||||
W3110 |
|
W3110: 556096..555884 |
||
DH10B: 495428..495216 |
||||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
ybcJ(del) (Keio:JW5070) |
deletion |
deletion |
PMID:16738554 |
||||
ybcJ739(del)::kan |
PMID:16738554 |
| |||||
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW5070 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCGCGACATTTTCTTTAGGTAA Primer 2:CCGGCAACAACCTGTACGCTGTG | |
Kohara Phage |
PMID:3038334 | ||
Kohara Phage |
PMID:3038334 | ||
Linked marker |
est. P1 cotransduction: 88% [6] | ||
Linked marker |
est. P1 cotransduction: % [6] | ||
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG12879 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG12879 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120002418 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EchoBASE:EB2717 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0001816 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
Standard name |
YbcJ |
---|---|
Synonyms |
predicted RNA-binding protein[1], YbcJ[2][1], B0528[2][1] , ECK0521, JW5070, b0528 |
Product description |
putative RNA-binding protein[2]; predicted RNA-binding protein[3] Ribosome-associated protein, function unknown; putative RNA binding protein[4] |
EC number (for enzymes) |
|
edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
---|---|---|---|---|---|---|---|---|
GO:0003723 |
RNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR002942 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0003723 |
RNA binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0694 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
Partner Type | Partner | Notes | References | Evidence |
---|---|---|---|---|
Protein |
pnp |
PMID:15690043 |
Experiment(s):EBI-878757, EBI-881754 | |
Protein |
pssA |
PMID:15690043 |
Experiment(s):EBI-878757 | |
Protein |
rhlB |
PMID:15690043 |
Experiment(s):EBI-878757 | |
Protein |
rplA |
PMID:15690043 |
Experiment(s):EBI-878757, EBI-881754 | |
Protein |
rplC |
PMID:15690043 |
Experiment(s):EBI-878757, EBI-881754 | |
Protein |
rplI |
PMID:15690043 |
Experiment(s):EBI-878757, EBI-881754 | |
Protein |
rpoA |
PMID:15690043 |
Experiment(s):EBI-878757 | |
Protein |
rpoC |
PMID:15690043 |
Experiment(s):EBI-878757 | |
Protein |
rpsA |
PMID:15690043 |
Experiment(s):EBI-878757, EBI-881754 | |
Protein |
rpsB |
PMID:15690043 |
Experiment(s):EBI-878757, EBI-881754 | |
Protein |
rpsC |
PMID:15690043 |
Experiment(s):EBI-878757, EBI-881754 | |
Protein |
srmB |
PMID:15690043 |
Experiment(s):EBI-878757 | |
Protein |
yajQ |
PMID:15690043 |
Experiment(s):EBI-878757 | |
Protein |
ycbY |
PMID:15690043 |
Experiment(s):EBI-878757 | |
Protein |
rluC |
PMID:15690043 |
Experiment(s):EBI-878757, EBI-890236 | |
Protein |
rluB |
PMID:15690043 |
Experiment(s):EBI-878757, EBI-881754 | |
Protein |
yfiF |
PMID:15690043 |
Experiment(s):EBI-878757, EBI-881754 | |
Protein |
ygiF |
PMID:15690043 |
Experiment(s):EBI-878757 | |
Protein |
yhiR |
PMID:15690043 |
Experiment(s):EBI-878757, EBI-881754 | |
Protein |
aceF |
PMID:15690043 |
Experiment(s):EBI-878757, EBI-881754 | |
Protein |
deaD |
PMID:15690043 |
Experiment(s):EBI-878757 | |
Protein |
dnaJ |
PMID:15690043 |
Experiment(s):EBI-878757, EBI-881754 | |
Protein |
lpdA |
PMID:15690043 |
Experiment(s):EBI-878757 | |
Protein |
aidB |
PMID:15690043 |
Experiment(s):EBI-878757 | |
Protein |
rnr |
PMID:15690043 |
Experiment(s):EBI-878757, EBI-881754 | |
Protein |
eno |
PMID:15690043 |
Experiment(s):EBI-881754 | |
Protein |
hupA |
PMID:15690043 |
Experiment(s):EBI-881754 | |
Protein |
hupB |
PMID:15690043 |
Experiment(s):EBI-881754 | |
Protein |
rne |
PMID:15690043 |
Experiment(s):EBI-881754 | |
Protein |
rplD |
PMID:15690043 |
Experiment(s):EBI-881754 | |
Protein |
rplF |
PMID:15690043 |
Experiment(s):EBI-881754 | |
Protein |
rplK |
PMID:15690043 |
Experiment(s):EBI-881754 | |
Protein |
rplL |
PMID:15690043 |
Experiment(s):EBI-881754 | |
Protein |
rplM |
PMID:15690043 |
Experiment(s):EBI-881754 | |
Protein |
rplQ |
PMID:15690043 |
Experiment(s):EBI-881754 | |
Protein |
rplR |
PMID:15690043 |
Experiment(s):EBI-881754 | |
Protein |
rplS |
PMID:15690043 |
Experiment(s):EBI-881754 | |
Protein |
rplT |
PMID:15690043 |
Experiment(s):EBI-881754 | |
Protein |
rplU |
PMID:15690043 |
Experiment(s):EBI-881754 | |
Protein |
rplV |
PMID:15690043 |
Experiment(s):EBI-881754 | |
Protein |
rplX |
PMID:15690043 |
Experiment(s):EBI-881754 | |
Protein |
rpmG |
PMID:15690043 |
Experiment(s):EBI-881754 | |
Protein |
rpsE |
PMID:15690043 |
Experiment(s):EBI-881754 | |
Protein |
rpsF |
PMID:15690043 |
Experiment(s):EBI-881754 | |
Protein |
rpsI |
PMID:15690043 |
Experiment(s):EBI-881754 | |
Protein |
yibL |
PMID:15690043 |
Experiment(s):EBI-881754, EBI-887431 | |
Protein |
yihI |
PMID:15690043 |
Experiment(s):EBI-881754 | |
Protein |
adhE |
PMID:19402753 |
MALDI(Z-score):20.164404 | |
Protein |
rpmG |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
eno |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rplK |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
dnaJ |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):28.474606 | |
Protein |
hupB |
PMID:19402753 |
LCMS(ID Probability):99.4 | |
Protein |
rpsA |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):28.270072 | |
Protein |
rplP |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rpsF |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
hupA |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rpsN |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rplT |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rpmB |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rpsT |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rplI |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):30.385625 | |
Protein |
rplR |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
hybC |
PMID:19402753 |
MALDI(Z-score):27.785239 | |
Protein |
rplS |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):2.146331 | |
Protein |
rplU |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rplX |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rplM |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
ihfA |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rpsD |
PMID:19402753 |
LCMS(ID Probability):99.3 MALDI(Z-score):28.004333 | |
Protein |
rplF |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):15.842353 | |
Protein |
rplB |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):20.914227 | |
Protein |
rplQ |
PMID:19402753 |
LCMS(ID Probability):99.2 | |
Protein |
rpoA |
PMID:19402753 |
MALDI(Z-score):35.894115 | |
Protein |
rpsC |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):33.954940 | |
Protein |
rplA |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):32.533390 | |
Protein |
prs |
PMID:19402753 |
MALDI(Z-score):26.749891 | |
Protein |
rplD |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):8.510244 | |
Protein |
yihI |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rlmL |
PMID:19402753 |
MALDI(Z-score):27.059128 | |
Protein |
srmB |
PMID:19402753 |
MALDI(Z-score):26.839928 | |
Protein |
aidB |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):38.246624 | |
Protein |
ygiF |
PMID:19402753 |
MALDI(Z-score):38.881696 | |
Protein |
hrpA |
PMID:19402753 |
MALDI(Z-score):18.662063 | |
Protein |
pnp |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):27.259636 | |
Protein |
rnr |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):28.162485 | |
Protein |
yfiF |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):36.415270 | |
Protein |
yhiR |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):35.708365 | |
Protein |
rne |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):13.497979 | |
Protein |
yibL |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):13.923336 | |
Protein |
pssA |
PMID:19402753 |
MALDI(Z-score):25.268877 | |
Protein |
rhlB |
PMID:19402753 |
MALDI(Z-score):37.343590 | |
Protein |
pcnB |
PMID:19402753 |
MALDI(Z-score):29.263305 | |
Protein |
deaD |
PMID:19402753 |
LCMS(ID Probability):81.3 MALDI(Z-score):27.822436 | |
edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
Compartment | Description | Evidence | Reference/Source | Notes |
---|---|---|---|---|
edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
Name | |
---|---|
Sequence |
MIHRMSNMAT FSLGKHPHVE LCDLLKLEGW SESGAQAKIA IAEGQVKVDG AVETRKRCKI VAGQTVSFAG HSVQVVA |
Length |
77 |
Mol. Wt |
8.258 kDa |
pI |
8.7 (calculated) |
Extinction coefficient |
5,500 - 5,750 (calc based on 0 Y, 1 W, and 2 C residues) |
edit table |
Domains/Motifs/Modification Sites
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
Resource type | Source | Notes/Reference |
---|---|---|
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
ASAP:ABE-0001816 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EcoCyc:EG12879 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG12879 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
RegulonDB:ECK120002418 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB2717 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
---|---|---|---|---|---|---|---|
Protein |
E. coli K-12 MC4100 |
6.13E+02 |
molecules/cell |
|
emPAI |
PMID:18304323 | |
Protein |
E. coli K-12 MG1655 |
3974 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
1294 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
1948 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:556076..556116
source=MG1655
flip=1
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
Allele Name | Mutation | Phenotype | Reference |
---|---|---|---|
edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
Type | Reference | Notes |
---|---|---|
microarray |
NCBI GEO profiles for ybcJ | |
microarray |
Summary of data for ybcJ from multiple microarray studies | |
edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
Resource Name | Resource Type | Description | Source | Notes |
---|---|---|---|---|
edit table |
<protect></protect>
Notes
Accessions Related to ybcJ Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG12879 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB2717 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG12879 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120002418 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0001816 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
Organism | Homologs (Statistics) | Comments |
---|---|---|
Anopheles gambiae |
|
From Inparanoid:20070104 |
Shigella flexneri |
YBCJ |
From SHIGELLACYC |
E. coli O157 |
YBCJ |
From ECOO157CYC |
edit table |
<protect></protect>
Notes
Families
<protect>
See Help:Evolution_families for help entering or editing information in this section of EcoliWiki.
Database | Accession | Notes |
---|---|---|
edit table |
</protect> <protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
Categories