uvrA:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
uvrA |
|---|---|
| Mnemonic |
Ultraviolet resistant |
| Synonyms |
ECK4050, b4058, JW4019, dar, dinE[1] |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
92.01 minutes, 92.01 minutes |
MG1655: 4271894..4269072 |
||
|
NC_012967: 4252803..4249981 |
||||
|
NC_012759: 4207917..4210739 |
||||
|
W3110 |
|
W3110: 4277461..4274639 |
||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
4269072 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
Strain DH10B |
V332L |
Nonsynonomous mutation |
This is a SNP in E. coli K-12 Strain DH10B | ||||
|
uvrA(del) (Keio:JW4019) |
deletion |
deletion |
|||||
|
uvrAC253A,H,S |
C253A,H,S |
Reduced activity |
seeded from UniProt:P0A698 | ||||
|
uvrA6 |
Sensitivity to |
Mutation increases sensitivity to UV-radiation |
Figure 5 Strain AB1157 | ||||
|
uvrA157 |
|||||||
|
uvrA103 |
|||||||
|
uvrA155 |
|||||||
|
uvrA277::Tn10 |
|||||||
|
uvrA37 |
Sensitivity to |
Mutation increases sensitivity to UV-radiation |
Figure 5 Strain Hfr J2 | ||||
|
uvrA14 |
|||||||
|
uvrA18 |
|||||||
|
uvrA19 |
|||||||
|
uvrA281 |
|||||||
|
uvrA154 |
|||||||
|
uvrA0 |
|||||||
|
uvrA215::Mud(Ap,lac) |
|||||||
|
uvrA753(del)::kan |
|||||||
|
uvrA(del)::Tn10 |
deletion |
deletion |
Sensitivity to |
Deletion mutants are more sensitive to DNA damaging agent Mitomycin C, fig 1 & 2. |
Experimental strain:GY5564 |
||
|
uvrA::Tn10 uvrC34 |
Sensitivity to |
Double mutation increased sensitivity to mitomycin C but at a slower rate than single deletions. |
Strain: |
See Figure 1. | |||
|
uvrA(del) |
deletion |
deletion |
Sensitivity to |
Deletion mutation causes hypersensitive to UV when irradiated and incubated in non-photoreactivating conditions, fig 2. |
figure 2 | ||
|
uvrA K689A |
Lysine to Alanine |
change in binding affinity |
Mutation caused a decrease in binding affinity to DNA, table 1. |
||||
|
uvrA K680E |
Lysine to Glutamic Acid |
Change in binding affinity |
Mutation caused a decrease in binding affinity to DNA, table 1. |
||||
|
uvrA R691A |
Arginine to Alanine |
Change in DNA binding affinity |
Mutation caused a decrease in binding affinity to DNA, table 1. |
||||
|
uvrA R691D |
Arginine to Aspartic Acid |
Change in binding affinity |
Mutation caused a decrease in binding affinity to DNA, table 1. |
||||
|
uvrA K680A R691A |
Lysine to Alanine & Arginine to Alanine |
Change in binding affinity |
Double mutation caused a decrease in binding affinity to DNA more than single point mutations, table 1. |
||||
|
uvrA::Tn10 uvrC34 |
DNA repair |
Double mutation was able to recover high molecular weight DNA, though at a much slower rate than wild type. |
Figure 4 | ||||
|
uvrAB K45A |
Lysine to alanine |
change in enzyme activity |
ATP hydrolysis of uvrB by ATPase is inhibited (but not of uvrA in the complex). Table 1. |
||||
|
ZnG uvrA |
11 amino acid change, figure 1. |
DNA binding |
Mutant shows decreased binding affinity to damaged DNA, table 1. |
||||
|
uvrA G502D V508D |
Glycine to Aspartic Acid & Valine to Aspartic Acid |
Sensitivity to |
Mutation increases sensitivity to UV-radiation by causing the loss of uvrA's binding specificity between damaged and undamaged DNA. Figure 7. |
Figure 7 Parent Strain: MH1-∆A | |||
|
uvrA G275A |
Glycine to Alanine |
Resistant to |
Mutation creates "hyper" UV resistance greater than the UV resistance of wild type, figure 4. |
Figure 4 | |||
|
uvrA C763F |
Cysteine to Phenylalanine |
Change in DNA binding |
Mutation causes loss of single-stranded DNA-binding activity. |
No data shown Parent Strain: MH1-A(del) | |||
|
uvrA C740F H754Y C742Y/K750I |
Cysteine to Phenylalanine & Histidine to Tyrosine & Cysteine to Tyrosine/Lysine to Isoleucine (double mutant) |
Sensitivity to |
Mutation increased UV sensitivity by making the mutant proteins excision repair defective |
No data shown in source. Parent Strain: MH1-A(del) | |||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW4019 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGATAAGATCGAAGTTCGGGG Primer 2:CCaAGCATCGGCTTAAGGAAGCG | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 33% [17] | ||
|
Linked marker |
est. P1 cotransduction: 22% [17] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Husain, I et al. (1986) Sequences of Escherichia coli uvrA gene and protein reveal two potential ATP binding sites. J. Biol. Chem. 261 4895-901 PubMed
- ↑ Durfee, T et al. (2008) The complete genome sequence of Escherichia coli DH10B: insights into the biology of a laboratory workhorse. J. Bacteriol. 190 2597-606 PubMed
- ↑ 4.0 4.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 Howard-Flanders, P et al. (1966) Three loci in Escherichia coli K-12 that control the excision of pyrimidine dimers and certain other mutagen products from DNA. Genetics 53 1119-36 PubMed
- ↑ Kenyon, CJ & Walker, GC (1980) DNA-damaging agents stimulate gene expression at specific loci in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 77 2819-23 PubMed
- ↑ Kenyon, CJ & Walker, GC (1981) Expression of the E. coli uvrA gene is inducible. Nature 289 808-10 PubMed
- ↑ 9.0 9.1 9.2 Vidal, LS et al. (2006) Enhanced sensitivity of Escherichia coli uvrB mutants to mitomycin C points to a UV-C distinct repair for DNA adducts. Chem. Res. Toxicol. 19 1351-6 PubMed
- ↑ Crowley, DJ et al. (2006) The uvrA, uvrB and uvrC genes are required for repair of ultraviolet light induced DNA photoproducts in Halobacterium sp. NRC-1. Saline Syst. 2 11 PubMed
- ↑ 11.0 11.1 11.2 11.3 11.4 Croteau, DL et al. (2008) Cooperative damage recognition by UvrA and UvrB: identification of UvrA residues that mediate DNA binding. DNA Repair (Amst.) 7 392-404 PubMed
- ↑ Malta, E et al. (2007) Dynamics of the UvrABC nucleotide excision repair proteins analyzed by fluorescence resonance energy transfer. Biochemistry 46 9080-8 PubMed
- ↑ Croteau, DL et al. (2006) The C-terminal zinc finger of UvrA does not bind DNA directly but regulates damage-specific DNA binding. J. Biol. Chem. 281 26370-81 PubMed
- ↑ 14.0 14.1 14.2 14.3 Wang, J & Grossman, L (1993) Mutations in the helix-turn-helix motif of the Escherichia coli UvrA protein eliminate its specificity for UV-damaged DNA. J. Biol. Chem. 268 5323-31 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 16.0 16.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 17.0 17.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
