tsf:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
| Standard Name |
tsf |
|---|---|
| Gene Synonym(s) |
ECK0169, b0170, JW0165[1], JW0165 |
| Product Desc. |
protein chain elongation factor EF-Ts[2][3] EF-Ts, Elongation Factor-Translation, stable; exchanges GDP for GTP in EF-Tu-GDP complex; binds Zn(II)[4] |
| Product Synonyms(s) |
protein chain elongation factor EF-Ts[1], B0170[2][1], Tsf[2][1], EF1B[2][1] , ECK0169, JW0165, b0170 |
| Function from GO |
<GO_nr /> |
| Knock-Out Phenotype | |
| Regulation/Expression | |
| Regulation/Activity | |
| Quick Links |
|
| edit table |
See Help:Quickview for help with entering information in the Quickview table.
Notes
Binds TrxA (Kumar, 2004). HT_Cmplx23_Cyt: FusA+Tsf+TufA. HT_Cmplx4_Cyt: Tsf+TufA.[4]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
tsf |
|---|---|
| Mnemonic |
Translation stable factor |
| Synonyms |
ECK0169, b0170, JW0165[1], JW0165 |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
4.11 minutes |
MG1655: 190857..191708 |
||
|
NC_012967: 193699..194550 |
||||
|
NC_012759: 190856..191707 |
||||
|
W3110 |
|
W3110: 190857..191708 |
||
|
DH10B: 164961..165812 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
190860 |
Edman degradation |
PMID:8740179 |
| |
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
tsfF82A |
F82A |
2 to 3-fold less active in promoting GDP exchange and 6-fold less active in binding to EF-Tu |
seeded from UniProt:P0A6P1 | ||||
|
tsfH148A |
H148A |
At least 100-fold decrease in affinity between EF-Ts and EF-Tu and only small amount of GDP exchange activity |
seeded from UniProt:P0A6P1 | ||||
|
tsfK24A |
K24A |
No change in binding to EF-Tu and in promoting GDP exchange |
seeded from UniProt:P0A6P1 | ||||
|
tsfD81A |
D81A |
2 to 3-fold less active in promoting GDP exchange and slightly lower binding constant for interaction with EF- Tu |
seeded from UniProt:P0A6P1 | ||||
| edit table |
Notes
Genetic Interactions
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0165 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCGCTGAAATTACCGCATCCCT Primer 2:CCAGACTGCTTGGACATCGCAGC | |
|
Kohara Phage |
PMID:3038334 | ||
|
Kohara Phage |
PMID:3038334 | ||
|
Linked marker |
est. P1 cotransduction: 16% [6] | ||
|
Linked marker |
est. P1 cotransduction: 17% [6] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG11033 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG11033 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120001022 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EchoBASE:EB1026 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0000579 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
Tsf |
|---|---|
| Synonyms |
protein chain elongation factor EF-Ts[1], B0170[2][1], Tsf[2][1], EF1B[2][1] , ECK0169, JW0165, b0170 |
| Product description |
protein chain elongation factor EF-Ts[2][3] EF-Ts, Elongation Factor-Translation, stable; exchanges GDP for GTP in EF-Tu-GDP complex; binds Zn(II)[4] |
| EC number (for enzymes) |
|
| edit table |
Notes
Function
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
| GO:0003746 |
translation elongation factor activity |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
F |
Seeded from EcoCyc (v14.0) |
complete | ||
| GO:0003746 |
translation elongation factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
F |
Seeded from EcoCyc (v14.0) |
complete | ||
| GO:0003746 |
translation elongation factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
F |
Seeded from EcoCyc (v14.0) |
complete | ||
| GO:0003746 |
translation elongation factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
F |
Seeded from EcoCyc (v14.0) |
complete | ||
| GO:0003746 |
translation elongation factor activity |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
F |
Seeded from EcoCyc (v14.0) |
complete | ||
| GO:0005737 |
cytoplasm |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
C |
Seeded from EcoCyc (v14.0) |
complete | ||
| GO:0005737 |
cytoplasm |
IEA: Inferred from Electronic Annotation |
SP_SL:SL-0086 |
C |
Seeded from EcoCyc (v14.0) |
complete | ||
| GO:0006412 |
translation |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
P |
Seeded from EcoCyc (v14.0) |
complete | ||
| GO:0006414 |
translational elongation |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
P |
Seeded from EcoCyc (v14.0) |
complete | ||
| GO:0008270 |
zinc ion binding |
IDA: Inferred from Direct Assay |
F |
complete | ||||
| GO:0006414 |
translational elongation |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
P |
Seeded from EcoCyc (v14.0) |
complete | ||
| GO:0006414 |
translational elongation |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
P |
Seeded from EcoCyc (v14.0) |
complete | ||
| GO:0006414 |
translational elongation |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
P |
Seeded from EcoCyc (v14.0) |
complete | ||
| GO:0016020 |
membrane |
IDA: Inferred from Direct Assay |
C |
Seeded from EcoCyc (v14.0) |
complete | |||
| edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
|
Protein |
tufA |
Experiment(s):EBI-880968, EBI-889981, EBI-887539, EBI-894882 | ||
|
Protein |
asr |
Experiment(s):EBI-887539 | ||
|
Protein |
ecpD |
Experiment(s):EBI-887539 | ||
|
Protein |
hsdM |
Experiment(s):EBI-887539 | ||
|
Protein |
rpsE |
Experiment(s):EBI-887539 | ||
|
Protein |
dnaC |
Experiment(s):EBI-1135775 | ||
|
Protein |
hsdM |
LCMS(ID Probability):99.0 | ||
|
Protein |
asr |
LCMS(ID Probability):99.0 | ||
|
Protein |
ecpD |
LCMS(ID Probability):99.0 | ||
| edit table |
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Reference/Source | Notes |
|---|---|---|---|---|
| edit table |
Notes
Structure and Physical Properties
Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Name | |
|---|---|
| Sequence |
MAEITASLVK ELRERTGAGM MDCKKALTEA NGDIELAIEN MRKSGAIKAA KKAGNVAADG VIKTKIDGNY GIILEVNCQT DFVAKDAGFQ AFADKVLDAA VAGKITDVEV LKAQFEEERV ALVAKIGENI NIRRVAALEG DVLGSYQHGA RIGVLVAAKG ADEELVKHIA MHVAASKPEF IKPEDVSAEV VEKEYQVQLD IAMQSGKPKE IAEKMVEGRM KKFTGEVSLT GQPFVMEPSK TVGQLLKEHN AEVTGFIRFE VGEGIEKVET DFAAEVAAMS KQS |
| Length |
283 |
| Mol. Wt |
30.422 kDa |
| pI |
5.1 (calculated) |
| Extinction coefficient |
4,470 - 4,720 (calc based on 3 Y, 0 W, and 2 C residues) |
| edit table |
Domains/Motifs/Modification Sites
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
|
Structure
|
Structure figures
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
ASAP:ABE-0000579 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EcoCyc:EG11033 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG11033 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
RegulonDB:ECK120001022 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB1026 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|
|
Protein |
E. coli K-12 MC4100 |
6.60E+04 |
molecules/cell |
|
emPAI |
PMID:18304323 | |
|
Protein |
Ecoli K-12 |
726.726+/-4.215 |
Molecules/cell |
|
Single Molecule Fluorescence |
PMID:20671182 | |
|
mRNA |
Ecoli K-12 |
0.875440658 |
Molecules/cell |
|
by RNA_Seq |
PMID:20671182 | |
|
Protein |
E. coli K-12 EMG2 |
2670 |
molecules/cell |
|
Quantitative protein sequencing |
Spot ID: M6 |
PMID: 9298646 |
|
Protein |
E. coli K-12 MG1655 |
95122 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
17031 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
57732 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
| edit table |
Notes
Transcription and Transcriptional Regulation
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
 |
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<gbrowseImage> name=NC_000913:190837..190877 source=MG1655 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for tsf | |
|
microarray |
Summary of data for tsf from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
|
GFP Fusion |
Intergenic region (190507..190884) fused to gfpmut2. |
GFP fusion described in Zaslaver, et al. | ||
| edit table |
<protect>
Notes
Accessions Related to tsf Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG11033 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB1026 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG11033 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120001022 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0000579 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Anopheles gambiae |
|
From Inparanoid:20070104 |
|
Apis mellifera |
|
From Inparanoid:20070104 |
|
Arabidopsis thaliana |
|
From Inparanoid:20070104 |
|
Bos taurus |
|
From Inparanoid:20070104 |
|
Caenorhabditis briggsae |
|
From Inparanoid:20070104 |
|
Caenorhabditis elegans |
|
From Inparanoid:20070104 |
|
Canis familiaris |
|
From Inparanoid:20070104 |
|
Ciona intestinalis |
|
From Inparanoid:20070104 |
|
Dictyostelium discoideum |
|
From Inparanoid:20070104 |
|
Drosophila melanogaster |
|
From Inparanoid:20070104 |
|
Drosophila pseudoobscura |
|
From Inparanoid:20070104 |
|
Homo sapiens |
|
From Inparanoid:20070104 |
|
Macaca mulatta |
|
From Inparanoid:20070104 |
|
Monodelphis domestica |
|
From Inparanoid:20070104 |
|
Mus musculus |
|
From Inparanoid:20070104 |
|
Oryza gramene |
|
From Inparanoid:20070104 |
|
Pan troglodytes |
|
From Inparanoid:20070104 |
|
Schizosaccharomyces pombe |
|
From Inparanoid:20070104 |
|
Takifugu rubripes |
|
From Inparanoid:20070104 |
|
Tetraodon nigroviridis |
|
From Inparanoid:20070104 |
|
Xenopus tropicalis |
|
From Inparanoid:20070104 |
|
Shigella flexneri |
TSF |
From SHIGELLACYC |
|
E. coli O157 |
TSF |
From ECOO157CYC |
| edit table |
Do-It-Yourself Web Tools
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG11033 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG11033 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120001022 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB1026 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0000579 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Katayama, A et al. (2002) Systematic search for zinc-binding proteins in Escherichia coli. Eur. J. Biochem. 269 2403-13 PubMed
- ↑ Lasserre, JP et al. (2006) A complexomic study of Escherichia coli using two-dimensional blue native/SDS polyacrylamide gel electrophoresis. Electrophoresis 27 3306-21 PubMed
- ↑ 9.0 9.1 9.2 9.3 9.4 Butland, G et al. (2005) Interaction network containing conserved and essential protein complexes in Escherichia coli. Nature 433 531-7 PubMed
- ↑ Arifuzzaman, M et al. (2006) Large-scale identification of protein-protein interaction of Escherichia coli K-12. Genome Res. 16 686-91 PubMed
- ↑ 11.0 11.1 11.2 Hu, P et al. (2009) Global functional atlas of Escherichia coli encompassing previously uncharacterized proteins. PLoS Biol. 7 e96 PubMed
- ↑ Macek, B et al. (2008) Phosphoproteome analysis of E. coli reveals evolutionary conservation of bacterial Ser/Thr/Tyr phosphorylation. Mol. Cell Proteomics 7 299-307 PubMed
- ↑ 13.0 13.1 Finn, RD et al. (2010) The Pfam protein families database. Nucleic Acids Res. 38 D211-22 PubMed
- ↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed
Categories
- GO:0003746 ! translation elongation factor activity
- GO:0005737 ! cytoplasm
- GO:0006412 ! translation
- GO:0006414 ! translational elongation
- GO:0008270 ! zinc ion binding
- GO:0016020 ! membrane
- Genes in OpenBioSystems with Promoter Fusions
- Genes with homologs in Anopheles gambiae
- Genes with homologs in Apis mellifera
- Genes with homologs in Arabidopsis thaliana
- Genes with homologs in Bos taurus
- Genes with homologs in Caenorhabditis briggsae
- Genes with homologs in Caenorhabditis elegans
- Genes with homologs in Canis familiaris
- Genes with homologs in Ciona intestinalis
- Genes with homologs in Dictyostelium discoideum
- Genes with homologs in Drosophila melanogaster
- Genes with homologs in Drosophila pseudoobscura
- Genes with homologs in Homo sapiens
- Genes with homologs in Macaca mulatta
- Genes with homologs in Monodelphis domestica
- Genes with homologs in Mus musculus
- Genes with homologs in Oryza gramene
- Genes with homologs in Pan troglodytes
- Genes with homologs in Schizosaccharomyces pombe
- Genes with homologs in Takifugu rubripes
- Genes with homologs in Tetraodon nigroviridis
- Genes with homologs in Xenopus tropicalis
- Genes with homologs in Shigella flexneri
- Genes with homologs in E. coli O157