trxB:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
trxB |
|---|---|
| Mnemonic |
Thioredoxin |
| Synonyms | |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
20.05 minutes |
MG1655: 931273..930308 |
||
|
NC_012967: 949108..948143 |
||||
|
NC_012759: 833276..834241 |
||||
|
W3110 |
|
W3110: 932472..931507 |
||
|
DH10B: 985201..984236 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
930311 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
trxB(del) (Keio:JW0871) |
deletion |
deletion |
|||||
|
trxB::Tn5KAN-2 (FB20247) |
Insertion at nt 609 in Plus orientation |
does not contain pKD46 | |||||
|
trxB20 |
|||||||
|
trxB15::kan |
|||||||
|
trxB786(del)::kan |
|||||||
|
trxB |
deletion |
Sensitivity to |
increases sensitivity to bicyclomycin |
fig 2 | |||
|
trxB786(del)::FRTKanFRT |
Mutagenesis rate |
Decreased stress-induced mutagenesis (SIM) phenotype. |
Parental Strain: SMR4562 Experimental Strain: SMR11969 |
Mutation Rate was comparatively weak, to other strains, with decrease only happening in 33-67% of wild type population. | |||
|
CAG45114 trxB786(del)::FRTKanFRT |
Deletion |
SigmaE activity |
Decrease in SigmaE activity |
Parental Strain: CAG45114 Experimental Strain: SMR15283 |
See table S11 for full experimental data. | ||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0871 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGGCACGACCAAACACAGTAA Primer 2:CCTTTTGCGTCAGCTAAACCATC | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
zbh-29::Tn10 |
Linked marker |
est. P1 cotransduction: % [12] | |
|
zca-1230::Tn10 |
Linked marker |
est. P1 cotransduction: 56% [12] | |
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ Ueshima, R et al. (1992) Identification of Escherichia coli proteins cross-reacting with antibodies against region 2.2 peptide of RNA polymerase sigma subunit. Biochem. Biophys. Res. Commun. 184 634-9 PubMed
- ↑ Russel, M & Model, P (1988) Sequence of thioredoxin reductase from Escherichia coli. Relationship to other flavoprotein disulfide oxidoreductases. J. Biol. Chem. 263 9015-9 PubMed
- ↑ 5.0 5.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 6.0 6.1 6.2 CGSC: The Coli Genetics Stock Center
- ↑ Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ Tran, L et al. (2011) Single-gene deletion mutants of Escherichia coli with altered sensitivity to bicyclomycin, an inhibitor of transcription termination factor Rho. J. Bacteriol. 193 2229-35 PubMed
- ↑ 9.0 9.1 Al Mamun, AA et al. (2012) Identity and function of a large gene network underlying mutagenic repair of DNA breaks. Science 338 1344-8 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 11.0 11.1 11.2 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 12.0 12.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
