topA:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
topA |
|---|---|
| Mnemonic |
Topoisomerase |
| Synonyms | |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
28.65 minutes |
MG1655: 1329072..1331669 |
||
|
NC_012967: 1329420..1332017 |
||||
|
NC_012759: 1219921..1222518 |
||||
|
W3110 |
|
W3110: 1332762..1335359 |
||
|
DH10B: 1418468..1421065 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
1329075 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
topA66 |
|||||||
|
topA10 |
|||||||
|
topA75(del) |
|||||||
|
topA(del) topB(del) |
chromosomal segregation defect is due to a defect in recombination, not decatenation |
||||||
|
SY791 top-10 |
Point Mutation |
Plasmid Recombination |
Decrease in Plasmid recombination |
See Figure 2 for experimental data. | |||
|
SY791 top-10 |
Point Mutation |
Supercoiling |
Decrease in Super-coiling |
See Figure 2 for experimental data. | |||
|
SY791 DE(topA-cysB) 700 |
deletion |
Plasmid Recombination |
Decrease in Plasmid Recombination |
See figure 2 for experimental data. | |||
|
SY791 DE(topA-cysB) 700 |
deletion |
Supercoiling |
Decrease in Supercoiling |
See figure 2 for experimental data. | |||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW1266 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGGTAAAGCTCTTGTCATCGT Primer 2:CCTTTTTTTCCTTCAACCCATTT | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 67% [11] | ||
|
Linked marker |
est. P1 cotransduction: 19% [11] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ Tse-Dinh, YC & Wang, JC (1986) Complete nucleotide sequence of the topA gene encoding Escherichia coli DNA topoisomerase I. J. Mol. Biol. 191 321-31 PubMed
- ↑ Biek, DP & Cohen, SN (1989) Involvement of integration host factor (IHF) in maintenance of plasmid pSC101 in Escherichia coli: mutations in the topA gene allow pSC101 replication in the absence of IHF. J. Bacteriol. 171 2066-74 PubMed
- ↑ Stupina, VA & Wang, JC (2005) Viability of Escherichia coli topA mutants lacking DNA topoisomerase I. J. Biol. Chem. 280 355-60 PubMed
- ↑ Zhu, Q et al. (2001) Type I topoisomerase activity is required for proper chromosomal segregation in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 98 9766-71 PubMed
- ↑ 7.0 7.1 7.2 7.3 Fishel, RA & Kolodner, R (1984) Escherichia coli strains containing mutations in the structural gene for topoisomerase I are recombination deficient. J. Bacteriol. 160 1168-70 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 9.0 9.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 10.0 10.1 CGSC: The Coli Genetics Stock Center
- ↑ 11.0 11.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
