tonB:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Standard Name |
tonB |
---|---|
Gene Synonym(s) |
ECK1246, b1252, JW5195, T1rec, exbA[1], exbA |
Product Desc. |
TonB protein; energy transducer; uptake of iron, cyanocobalimin; sensitivity to phages, colicins[2][3]; Component of TonB energy transducing system[3]; Outer Membrane Ferric Citrate Transport System[3]; Outer Membrane Ferrichrome Transport System[3]; Outer Membrane Ferric Enterobactin Transport System[3]; vitamin B12 outer membrane transport complex[3]; ferric dicitrate uptake system[3]; ferrichrome uptake system[3]; Ferric Enterobactin Transport System[3]; vitamin B12 transport system[3] Uptake of chelated Fe(2+) and cyanocobalamin; works in conjunction with OM receptors; energy transducer; sensitivity to T1, phi80, and colicins; forms a complex with ExbB and ExbD[4] |
Product Synonyms(s) |
membrane spanning protein in TonB-ExbB-ExbD complex[1], B1252[2][1], ExbA[2][1], TonB[2][1] , ECK1246, exbA, JW5195, T1rec, b1252 |
Function from GO |
<GO_nr /> |
Knock-Out Phenotype | |
Regulation/Expression | |
Regulation/Activity | |
Quick Links | |
edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
Periplasmic TonB is anchored to the cytoplasmic membrane by a signal anchor and interacts with outer membrane proteins, thus TonB spans the periplasmic space. TonB contains 40 proline residues (17%).[4]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
tonB |
---|---|
Mnemonic |
T-one |
Synonyms |
ECK1246, b1252, JW5195, T1rec, exbA[1], exbA |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
28.22 minutes |
MG1655: 1309113..1309832 |
||
NC_012967: 1308683..1309402 |
||||
NC_012759: 1199962..1200681 |
||||
W3110 |
|
W3110: 1312803..1313522 |
||
DH10B: 1398509..1399228 |
||||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
tonB(del) (Keio:JW5195) |
deletion |
deletion |
PMID:16738554 |
||||
tonB |
Deletion | ||||||
tonBV114I |
V114I |
(in strain: ECOR 28) |
Strain variation; seeded from UniProt:P02929 | ||||
tonBV87A |
V87A |
(in strain: ECOR 37 and ECOR 71) |
Strain variation; seeded from UniProt:P02929 | ||||
tonBP102PKP |
P102PKP |
(in strain: ECOR 50) |
Strain variation; seeded from UniProt:P02929 | ||||
tonBE70K |
E70K |
(in strain: ECOR 31) |
Strain variation; seeded from UniProt:P02929 | ||||
tonBT51A |
T51A |
(in strain: ECOR 28, ECOR 31, ECOR 37, ECOR 46, ECOR 50, ECOR 52, ECOR 60 and ECOR 71) |
Strain variation; seeded from UniProt:P02929 | ||||
tonBL133P |
L133P |
(in strain: ECOR 16, ECOR 31, ECOR 46, ECOR 50, ECOR 52 and ECOR 60) |
Strain variation; seeded from UniProt:P02929 | ||||
tonBV176I |
V176I |
(in strain: ECOR 60) |
Strain variation; seeded from UniProt:P02929 | ||||
tonB50 |
|||||||
tonB56 |
|||||||
tonB54 |
|||||||
tonB51 |
|||||||
tonB52 |
|||||||
tonB760(del)::kan |
PMID:16738554 |
||||||
del(tonB-trp) |
Deletion |
Deletion |
Cobalamin uptake defect |
Mutants can't take up cobalamin |
PMID:6768753 |
Strain name: 1485F- | |
TonB- |
Resistant to |
Resistant to several colicins and bacteriophage 80. |
PMID:3309133 |
See page 3255 | |||
tonB2 |
Metabolic response |
Decrease in the uptake of Vitamin B12 |
PMID:135755 |
A mutation to the tonBcaused a decrease in the ability of the cell to metabolize Vitamin B12. See figure 1 for full experimental results. | |||
tonB(del)-trp |
Deletion, Tyrptophan auxotrophy |
Metabolic response |
Decrease in the uptake of Vitamin B12 |
PMID:135755 |
A mutation to the tonBcaused a decrease in the ability of the cell to metabolize Vitamin B12. See figure 1 for full experimental results. | ||
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW5195 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCACCCTTGATTTACCTCGCCG Primer 2:CCtTGAATTTCGGTGGTGCCGTT | |
Kohara Phage |
PMID:3038334 | ||
Linked marker |
est. P1 cotransduction: 84% [6] | ||
Linked marker |
est. P1 cotransduction: 75% [6] | ||
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG11012 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG11012 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120001001 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EchoBASE:EB1005 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0004196 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
Standard name |
TonB |
---|---|
Synonyms |
membrane spanning protein in TonB-ExbB-ExbD complex[1], B1252[2][1], ExbA[2][1], TonB[2][1] , ECK1246, exbA, JW5195, T1rec, b1252 |
Product description |
TonB protein; energy transducer; uptake of iron, cyanocobalimin; sensitivity to phages, colicins[2][3]; Component of TonB energy transducing system[3]; Outer Membrane Ferric Citrate Transport System[3]; Outer Membrane Ferrichrome Transport System[3]; Outer Membrane Ferric Enterobactin Transport System[3]; vitamin B12 outer membrane transport complex[3]; ferric dicitrate uptake system[3]; ferrichrome uptake system[3]; Ferric Enterobactin Transport System[3]; vitamin B12 transport system[3] Uptake of chelated Fe(2+) and cyanocobalamin; works in conjunction with OM receptors; energy transducer; sensitivity to T1, phi80, and colicins; forms a complex with ExbB and ExbD[4] |
EC number (for enzymes) |
|
edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
---|---|---|---|---|---|---|---|---|
GO:0005381 |
iron ion transmembrane transporter activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR003538 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005886 |
plasma membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0997 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005886 |
plasma membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-1003 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006810 |
transport |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0813 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006826 |
iron ion transport |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR003538 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0008565 |
protein transporter activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR006260 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0009597 |
detection of virus |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0580 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0015031 |
protein transport |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR006260 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0015031 |
protein transport |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0653 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0015889 |
cobalamin transport |
PMID:11790740 |
IGI: Inferred from Genetic Interaction |
P |
Seeded from EcoCyc (v14.0) |
Missing: with/from | ||
GO:0016020 |
membrane |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR006260 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016020 |
membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0472 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0015889 |
cobalamin transport |
PMID:11790740 |
IGI: Inferred from Genetic Interaction |
EcoliWiki:metE |
P |
complete | ||
GO:0016021 |
integral to membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0812 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0030288 |
outer membrane-bounded periplasmic space |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR003538 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0030288 |
outer membrane-bounded periplasmic space |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR006260 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0043213 |
bacteriocin transport |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0080 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0046718 |
entry of virus into host cell |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0580 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
Partner Type | Partner | Notes | References | Evidence |
---|---|---|---|---|
Protein |
Subunits of TonB energy transducing system |
could be indirect |
||
Protein |
rplS |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rplM |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rpsP |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rpsJ |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
eno |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
yfiD |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rplJ |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
Subunits of Outer Membrane Ferric Citrate Transport System |
could be indirect |
||
Protein |
Subunits of Outer Membrane Ferrichrome Transport System |
could be indirect |
||
Protein |
Subunits of Outer Membrane Ferric Enterobactin Transport System |
could be indirect |
||
Protein |
Subunits of vitamin B12 outer membrane transport complex |
could be indirect |
||
Protein |
Subunits of ferric dicitrate uptake system |
could be indirect |
||
Protein |
Subunits of ferrichrome uptake system |
could be indirect |
||
Protein |
Subunits of Ferric Enterobactin Transport System |
could be indirect |
||
Protein |
Subunits of vitamin B12 transport system |
could be indirect |
| |
edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
Compartment | Description | Evidence | Reference/Source | Notes |
---|---|---|---|---|
edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
Name | |
---|---|
Sequence |
MTLDLPRRFP WPTLLSVCIH GAVVAGLLYT SVHQVIELPA PAQPISVTMV TPADLEPPQA VQPPPEPVVE PEPEPEPIPE PPKEAPVVIE KPKPKPKPKP KPVKKVQEQP KRDVKPVESR PASPFENTAP ARLTSSTATA ATSKPVTSVA SGPRALSRNQ PQYPARAQAL RIEGQVKVKF DVTPDGRVDN VQILSAKPAN MFEREVKNAM RRWRYEPGKP GSGIVVNILF KINGTTEIQ |
Length |
239 |
Mol. Wt |
26.093 kDa |
pI |
10.0 (calculated) |
Extinction coefficient |
15,470 - 15,595 (calc based on 3 Y, 2 W, and 1 C residues) |
edit table |
Domains/Motifs/Modification Sites
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
Resource type | Source | Notes/Reference |
---|---|---|
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
ASAP:ABE-0004196 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EcoCyc:EG11012 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG11012 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
RegulonDB:ECK120001001 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB1005 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
---|---|---|---|---|---|---|---|
Protein |
E. coli K-12 MG1655 |
647 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
218 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
199 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
![]() Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:1309093..1309133
source=MG1655
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
Allele Name | Mutation | Phenotype | Reference |
---|---|---|---|
edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
Type | Reference | Notes |
---|---|---|
microarray |
NCBI GEO profiles for tonB | |
microarray |
Summary of data for tonB from multiple microarray studies | |
edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
Resource Name | Resource Type | Description | Source | Notes |
---|---|---|---|---|
GFP Fusion |
Intergenic region (1308889..1309123) fused to gfpmut2. |
GFP fusion described in Zaslaver, et al. | ||
edit table |
<protect></protect>
Notes
Accessions Related to tonB Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG11012 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB1005 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG11012 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120001001 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0004196 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
Organism | Homologs (Statistics) | Comments |
---|---|---|
Oryza gramene |
|
From Inparanoid:20070104 |
Rattus norvegicus |
|
From Inparanoid:20070104 |
Xenopus tropicalis |
|
From Inparanoid:20070104 |
Shigella flexneri |
TONB |
From SHIGELLACYC |
E. coli O157 |
TONB |
From ECOO157CYC |
edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG11012 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG11012 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120001001 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB1005 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0004196 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 1.9 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.00 3.01 3.02 3.03 3.04 3.05 3.06 3.07 3.08 3.09 3.10 3.11 3.12 3.13 3.14 3.15 3.16 3.17 3.18 3.19 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed
Categories