{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	tonB
Gene Synonym(s)	ECK1246, b1252, JW5195, T1rec, exbA^[1], exbA
Product Desc.	TonB protein; energy transducer; uptake of iron, cyanocobalimin; sensitivity to phages, colicins^[2]^[3]; Component of TonB energy transducing system^[3]; Outer Membrane Ferric Citrate Transport System^[3]; Outer Membrane Ferrichrome Transport System^[3]; Outer Membrane Ferric Enterobactin Transport System^[3]; vitamin B12 outer membrane transport complex^[3]; ferric dicitrate uptake system^[3]; ferrichrome uptake system^[3]; Ferric Enterobactin Transport System^[3]; vitamin B12 transport system^[3] Uptake of chelated Fe(2+) and cyanocobalamin; works in conjunction with OM receptors; energy transducer; sensitivity to T1, phi80, and colicins; forms a complex with ExbB and ExbD^[4]
Product Synonyms(s)	membrane spanning protein in TonB-ExbB-ExbD complex^[1], B1252^[2]^[1], ExbA^[2]^[1], TonB^[2]^[1] , ECK1246, exbA, JW5195, T1rec, b1252
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): tonB^[2], OP00228
Regulation/Activity
Quick Links
edit table

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]

Periplasmic TonB is anchored to the cytoplasmic membrane by a signal anchor and interacts with outer membrane proteins, thus TonB spans the periplasmic space. TonB contains 40 proline residues (17%).^[4]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	tonB
Mnemonic	T-one
Synonyms	ECK1246, b1252, JW5195, T1rec, exbA^[1], exbA
edit table

</protect>

Notes

Location(s) and DNA Sequence

[back to top]

<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	28.22 minutes	MG1655: 1309113..1309832 <gbrowseImage> name=NC_000913:1309113..1309832 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 1308683..1309402 <gbrowseImage> name=NC_012967:1308683..1309402 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 1199962..1200681 <gbrowseImage> name=NC_012759:1199962..1200681 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 1312803..1313522 <gbrowseImage> name=NC_007779:1312803..1313522 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 1398509..1399228 <gbrowseImage> name=NC_010473:1398509..1399228 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

</protect>

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Type	Phenotype: Description	Reference	Availability	Comments
tonB(del) (Keio:JW5195)	deletion	deletion			PMID:16738554	Shigen CGSC11229^[5]
tonB							Deletion
tonBV114I		V114I		(in strain: ECOR 28)			Strain variation; seeded from UniProt:P02929
tonBV87A		V87A		(in strain: ECOR 37 and ECOR 71)			Strain variation; seeded from UniProt:P02929
tonBP102PKP		P102PKP		(in strain: ECOR 50)			Strain variation; seeded from UniProt:P02929
tonBE70K		E70K		(in strain: ECOR 31)			Strain variation; seeded from UniProt:P02929
tonBT51A		T51A		(in strain: ECOR 28, ECOR 31, ECOR 37, ECOR 46, ECOR 50, ECOR 52, ECOR 60 and ECOR 71)			Strain variation; seeded from UniProt:P02929
tonBL133P		L133P		(in strain: ECOR 16, ECOR 31, ECOR 46, ECOR 50, ECOR 52 and ECOR 60)			Strain variation; seeded from UniProt:P02929
tonBV176I		V176I		(in strain: ECOR 60)			Strain variation; seeded from UniProt:P02929
tonB50						CGSC:8587
tonB56						CGSC:12159
tonB54						CGSC:73826
tonB51						CGSC:79072
tonB52						CGSC:79073
tonB760(del)::kan					PMID:16738554	CGSC:103172
del(tonB-trp)	Deletion	Deletion	Cobalamin uptake defect	Mutants can't take up cobalamin	PMID:6768753		Strain name: 1485F-
TonB^-			Resistant to	Resistant to several colicins and bacteriophage 80.	PMID:3309133		See page 3255
tonB2			Metabolic response	Decrease in the uptake of Vitamin B₁₂	PMID:135755		A mutation to the tonBcaused a decrease in the ability of the cell to metabolize Vitamin B₁₂. See figure 1 for full experimental results.
tonB(del)-trp	Deletion, Tyrptophan auxotrophy		Metabolic response	Decrease in the uptake of Vitamin B₁₂	PMID:135755		A mutation to the tonBcaused a decrease in the ability of the cell to metabolize Vitamin B₁₂. See figure 1 for full experimental results.
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

</protect>

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW5195	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCACCCTTGATTTACCTCGCCG Primer 2:CCtTGAATTTCGGTGGTGCCGTT
14C4	Kohara Phage	Genobase	PMID:3038334
oppC506::Tn10	Linked marker	CAG12169 = CGSC7369^[5]	est. P1 cotransduction: 84% ^[6] Synonyms:zch-506::Tn10, zci-506::Tn10
trpC83::Tn10	Linked marker	CAG18455 = CGSC7371^[5]	est. P1 cotransduction: 75% ^[6] Synonyms:trpB83::Tn10
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG11012	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG11012	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001001	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:945843	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1005	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0004196	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	TonB
Synonyms	membrane spanning protein in TonB-ExbB-ExbD complex^[1], B1252^[2]^[1], ExbA^[2]^[1], TonB^[2]^[1] , ECK1246, exbA, JW5195, T1rec, b1252
Product description	TonB protein; energy transducer; uptake of iron, cyanocobalimin; sensitivity to phages, colicins^[2]^[3]; Component of TonB energy transducing system^[3]; Outer Membrane Ferric Citrate Transport System^[3]; Outer Membrane Ferrichrome Transport System^[3]; Outer Membrane Ferric Enterobactin Transport System^[3]; vitamin B12 outer membrane transport complex^[3]; ferric dicitrate uptake system^[3]; ferrichrome uptake system^[3]; Ferric Enterobactin Transport System^[3]; vitamin B12 transport system^[3] Uptake of chelated Fe(2+) and cyanocobalamin; works in conjunction with OM receptors; energy transducer; sensitivity to T1, phi80, and colicins; forms a complex with ExbB and ExbD^[4]
EC number (for enzymes)
edit table

Notes

Function

[back to top]

<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0005381	iron ion transmembrane transporter activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR003538	F	Seeded from EcoCyc (v14.0)	complete
	GO:0005886	plasma membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0997	C	Seeded from EcoCyc (v14.0)	complete
	GO:0005886	plasma membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-1003	C	Seeded from EcoCyc (v14.0)	complete
	GO:0006810	transport	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0813	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006826	iron ion transport	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR003538	P	Seeded from EcoCyc (v14.0)	complete
	GO:0008565	protein transporter activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR006260	F	Seeded from EcoCyc (v14.0)	complete
	GO:0009597	detection of virus	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0580	P	Seeded from EcoCyc (v14.0)	complete
	GO:0015031	protein transport	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR006260	P	Seeded from EcoCyc (v14.0)	complete
	GO:0015031	protein transport	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0653	P	Seeded from EcoCyc (v14.0)	complete
	GO:0015889	cobalamin transport	PMID:11790740	IGI: Inferred from Genetic Interaction		P	Seeded from EcoCyc (v14.0)	Missing: with/from
	GO:0016020	membrane	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR006260	C	Seeded from EcoCyc (v14.0)	complete
	GO:0016020	membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0472	C	Seeded from EcoCyc (v14.0)	complete
	GO:0015889	cobalamin transport	PMID:11790740	IGI: Inferred from Genetic Interaction	EcoliWiki:metE	P		complete
	GO:0016021	integral to membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0812	C	Seeded from EcoCyc (v14.0)	complete
	GO:0030288	outer membrane-bounded periplasmic space	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR003538	C	Seeded from EcoCyc (v14.0)	complete
	GO:0030288	outer membrane-bounded periplasmic space	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR006260	C	Seeded from EcoCyc (v14.0)	complete
	GO:0043213	bacteriocin transport	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0080	P	Seeded from EcoCyc (v14.0)	complete
	GO:0046718	entry of virus into host cell	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0580	P	Seeded from EcoCyc (v14.0)	complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	Notes	References	Evidence
Protein	Subunits of TonB energy transducing system	could be indirect
Protein	rplS		PMID:19402753	LCMS(ID Probability):99.6
Protein	rplM		PMID:19402753	LCMS(ID Probability):99.6
Protein	rpsP		PMID:19402753	LCMS(ID Probability):99.6
Protein	rpsJ		PMID:19402753	LCMS(ID Probability):99.6
Protein	eno		PMID:19402753	LCMS(ID Probability):99.6
Protein	yfiD		PMID:19402753	LCMS(ID Probability):99.6
Protein	rplJ		PMID:19402753	LCMS(ID Probability):99.6
Protein	Subunits of Outer Membrane Ferric Citrate Transport System	could be indirect
Protein	Subunits of Outer Membrane Ferrichrome Transport System	could be indirect
Protein	Subunits of Outer Membrane Ferric Enterobactin Transport System	could be indirect
Protein	Subunits of vitamin B12 outer membrane transport complex	could be indirect
Protein	Subunits of ferric dicitrate uptake system	could be indirect
Protein	Subunits of ferrichrome uptake system	could be indirect
Protein	Subunits of Ferric Enterobactin Transport System	could be indirect
Protein	Subunits of vitamin B12 transport system	could be indirect
edit table

</protect>

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source	Notes
edit table

Notes

Structure and Physical Properties

[back to top]

<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MTLDLPRRFP WPTLLSVCIH GAVVAGLLYT SVHQVIELPA PAQPISVTMV TPADLEPPQA VQPPPEPVVE PEPEPEPIPE PPKEAPVVIE KPKPKPKPKP KPVKKVQEQP KRDVKPVESR PASPFENTAP ARLTSSTATA ATSKPVTSVA SGPRALSRNQ PQYPARAQAL RIEGQVKVKF DVTPDGRVDN VQILSAKPAN MFEREVKNAM RRWRYEPGKP GSGIVVNILF KINGTTEIQ
Length	239
Mol. Wt	26.093 kDa
pI	10.0 (calculated)
Extinction coefficient	15,470 - 15,595 (calc based on 3 Y, 2 W, and 1 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
Domain	159..233	PF03544 Gram-negative bacterial tonB protein		PMID:19920124
edit table

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=tonB taxon=562,83333 </beststructure>

Models

View models at:

edit table

</protect>

Structure figures

</protect>

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16129213	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:945843	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0004196	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P02929	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:EG11012	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG11012	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:945843	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001001	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1005	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Reference(s)
Protein	E. coli K-12 MG1655	647	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
Protein	E. coli K-12 MG1655	218	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
Protein	E. coli K-12 MG1655	199	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
tonB
edit table

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<protect><gbrowseImage> name=NC_000913:1309093..1309133 source=MG1655 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b1252 (EcoliWiki Page)	NCBI GEO profiles for tonB
microarray	GenExpDB:b1252 (EcoliWiki Page)	Summary of data for tonB from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
	GFP Fusion	Intergenic region (1308889..1309123) fused to gfpmut2.	OpenBioSystems	GFP fusion described in Zaslaver, et al. Plate:109-AZ16; Well:E4^[7]
edit table

Notes

Accessions Related to tonB Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG11012	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1005	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b1252
EcoGene	EcoGene:EG11012	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001001	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0004196	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Oryza gramene	Q41805 (score: 1.000; bootstrap: 100%) Q9SPM0 (score: 0.620) Q8L3T8 (score: 0.178) Q6YXX5 (score: 0.172) Q5ZB68 (score: 0.170) Q5VR46 (score: 0.167) Q8LJ87 (score: 0.162) Q5Z8W0 (score: 0.156) Q5KQK4 (score: 0.125) Q6F383 (score: 0.106) Q6ZEZ7 (score: 0.105) Q75J37 (score: 0.093) Q7F8X9 (score: 0.068) Q7XR58 (score: 0.068) Q84PC5 (score: 0.068) Q40692 (score: 0.067) Q41719 (score: 0.066) Q01979 (score: 0.064) Q9ZNY1 (score: 0.061) Q42366 (score: 0.059) Q7XQY2 (score: 0.058) P14918 (score: 0.054) Q41814 (score: 0.053) Q6AVC2 (score: 0.052) Q8W265 (score: 0.052) O49870 (score: 0.051)	From Inparanoid:20070104
Rattus norvegicus	ENSRNOP00000000124 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Xenopus tropicalis	ENSXETP00000029276 (score: 1.000; bootstrap: 100%) ENSXETP00000045988 (score: 0.663) ENSXETP00000045372 (score: 0.562) ENSXETP00000015278 (score: 0.550) ENSXETP00000028372 (score: 0.522) ENSXETP00000015667 (score: 0.497) ENSXETP00000007798 (score: 0.349) ENSXETP00000046021 (score: 0.345) ENSXETP00000013954 (score: 0.327) ENSXETP00000031512 (score: 0.251) ENSXETP00000033776 (score: 0.245) ENSXETP00000028661 (score: 0.240) ENSXETP00000023360 (score: 0.216) ENSXETP00000031264 (score: 0.216) ENSXETP00000003624 (score: 0.211) ENSXETP00000016831 (score: 0.208) ENSXETP00000002917 (score: 0.206) ENSXETP00000030437 (score: 0.203) ENSXETP00000016412 (score: 0.196) ENSXETP00000030739 (score: 0.194) ENSXETP00000001655 (score: 0.193) ENSXETP00000028777 (score: 0.189) ENSXETP00000027710 (score: 0.187) ENSXETP00000050098 (score: 0.185) ENSXETP00000032380 (score: 0.174) ENSXETP00000016469 (score: 0.170) ENSXETP00000005802 (score: 0.170) ENSXETP00000029712 (score: 0.157) ENSXETP00000002625 (score: 0.149) ENSXETP00000052478 (score: 0.148) ENSXETP00000011127 (score: 0.140) ENSXETP00000029704 (score: 0.115) ENSXETP00000015678 (score: 0.115) ENSXETP00000007521 (score: 0.114) ENSXETP00000043561 (score: 0.110) ENSXETP00000035410 (score: 0.109) ENSXETP00000009272 (score: 0.109) ENSXETP00000027961 (score: 0.105) ENSXETP00000032396 (score: 0.103) ENSXETP00000048549 (score: 0.101) ENSXETP00000036796 (score: 0.101) ENSXETP00000027557 (score: 0.095) ENSXETP00000019089 (score: 0.092) ENSXETP00000050562 (score: 0.091) ENSXETP00000052158 (score: 0.090) ENSXETP00000042877 (score: 0.087) ENSXETP00000033468 (score: 0.083) ENSXETP00000018693 (score: 0.082) ENSXETP00000022571 (score: 0.078) ENSXETP00000009601 (score: 0.078) ENSXETP00000023764 (score: 0.075) ENSXETP00000021256 (score: 0.073) ENSXETP00000027618 (score: 0.072) ENSXETP00000023532 (score: 0.071) ENSXETP00000022063 (score: 0.069) ENSXETP00000048832 (score: 0.067) ENSXETP00000045229 (score: 0.067) ENSXETP00000000275 (score: 0.067) ENSXETP00000042992 (score: 0.065) ENSXETP00000005609 (score: 0.064) ENSXETP00000034144 (score: 0.063) ENSXETP00000044630 (score: 0.059) ENSXETP00000002630 (score: 0.056) ENSXETP00000011736 (score: 0.055) ENSXETP00000043322 (score: 0.054) ENSXETP00000018815 (score: 0.054) ENSXETP00000001545 (score: 0.054) ENSXETP00000024240 (score: 0.054) ENSXETP00000004917 (score: 0.053) ENSXETP00000022681 (score: 0.053) ENSXETP00000021062 (score: 0.053)	From Inparanoid:20070104
Shigella flexneri	TONB	From SHIGELLACYC
E. coli O157	TONB	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Superfamily (EcoliWiki Page)	SUPERFAMILY:74653
Pfam (EcoliWiki Page)	PF03544 Gram-negative bacterial tonB protein
EcoCyc	EcoCyc:EG11012	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG11012	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001001	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1005	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0004196	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 ^1.5 ^1.6 ^1.7 ^1.8 ^1.9 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.0 ^2.1 ^2.2 ^2.3 ^2.4 ^2.5 ^2.6 ^2.7 ^2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.00 ^3.01 ^3.02 ^3.03 ^3.04 ^3.05 ^3.06 ^3.07 ^3.08 ^3.09 ^3.10 ^3.11 ^3.12 ^3.13 ^3.14 ^3.15 ^3.16 ^3.17 ^3.18 ^3.19 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 ^4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ ^5.0 ^5.1 ^5.2 CGSC: The Coli Genetics Stock Center
↑ ^6.0 ^6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed

tonB:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to tonB Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search