tonB:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
tonB |
|---|---|
| Mnemonic |
T-one |
| Synonyms |
ECK1246, b1252, JW5195, T1rec, exbA[1], exbA |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
28.22 minutes |
MG1655: 1309113..1309832 |
||
|
NC_012967: 1308683..1309402 |
||||
|
NC_012759: 1199962..1200681 |
||||
|
W3110 |
|
W3110: 1312803..1313522 |
||
|
DH10B: 1398509..1399228 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
tonB(del) (Keio:JW5195) |
deletion |
deletion |
|||||
|
tonB |
Deletion | ||||||
|
tonBV114I |
V114I |
(in strain: ECOR 28) |
Strain variation; seeded from UniProt:P02929 | ||||
|
tonBV87A |
V87A |
(in strain: ECOR 37 and ECOR 71) |
Strain variation; seeded from UniProt:P02929 | ||||
|
tonBP102PKP |
P102PKP |
(in strain: ECOR 50) |
Strain variation; seeded from UniProt:P02929 | ||||
|
tonBE70K |
E70K |
(in strain: ECOR 31) |
Strain variation; seeded from UniProt:P02929 | ||||
|
tonBT51A |
T51A |
(in strain: ECOR 28, ECOR 31, ECOR 37, ECOR 46, ECOR 50, ECOR 52, ECOR 60 and ECOR 71) |
Strain variation; seeded from UniProt:P02929 | ||||
|
tonBL133P |
L133P |
(in strain: ECOR 16, ECOR 31, ECOR 46, ECOR 50, ECOR 52 and ECOR 60) |
Strain variation; seeded from UniProt:P02929 | ||||
|
tonBV176I |
V176I |
(in strain: ECOR 60) |
Strain variation; seeded from UniProt:P02929 | ||||
|
tonB50 |
|||||||
|
tonB56 |
|||||||
|
tonB54 |
|||||||
|
tonB51 |
|||||||
|
tonB52 |
|||||||
|
tonB760(del)::kan |
|||||||
|
del(tonB-trp) |
Deletion |
Deletion |
Cobalamin uptake defect |
Mutants can't take up cobalamin |
Strain name: 1485F- | ||
|
TonB- |
Resistant to |
Resistant to several colicins and bacteriophage 80. |
See page 3255 | ||||
|
tonB2 |
Metabolic response |
Decrease in the uptake of Vitamin B12 |
A mutation to the tonBcaused a decrease in the ability of the cell to metabolize Vitamin B12. See figure 1 for full experimental results. | ||||
|
tonB(del)-trp |
Deletion, Tyrptophan auxotrophy |
Metabolic response |
Decrease in the uptake of Vitamin B12 |
A mutation to the tonBcaused a decrease in the ability of the cell to metabolize Vitamin B12. See figure 1 for full experimental results. | |||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW5195 |
Plasmid clone |
Status:Clone OK Primer 1:GCCACCCTTGATTTACCTCGCCG Primer 2:CCtTGAATTTCGGTGGTGCCGTT | |
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 84% [9] | ||
|
Linked marker |
est. P1 cotransduction: 75% [9] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 3.0 3.1 3.2 CGSC: The Coli Genetics Stock Center
- ↑ Reynolds, PR et al. (1980) Transport of vitamin B12 in Escherichia coli. Some observations on the roles of the gene products of BtuC and TonB. J. Biol. Chem. 255 4313-9 PubMed
- ↑ Pugsley, AP et al. (1986) Microcin-E492-insensitive mutants of Escherichia coli K12. J. Gen. Microbiol. 132 3253-9 PubMed
- ↑ 6.0 6.1 Bassford, PJ Jr et al. (1976) Transport of vitamin B12 in tonB mutants of Escherichia coli. J. Bacteriol. 128 242-7 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).