sucA:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Standard Name |
sucA |
---|---|
Gene Synonym(s) |
ECK0714, b0726, JW0715, lys, met, lys+met[1] |
Product Desc. |
|
Product Synonyms(s) |
2-oxoglutarate decarboxylase, thiamin-requiring[1] , ECK0714, JW0715, lys, b0726 |
Function from GO |
<GO_nr /> |
Knock-Out Phenotype | |
Regulation/Expression |
transcription unit(s): sdhCDAB-sucABCD[3], OP00142, sdhCDAB, sucABCD[3], OP00143, suc |
Regulation/Activity | |
Quick Links | |
edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
sucAB is a synthetic lethal with sucCD.[2]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
sucA |
---|---|
Mnemonic |
Succinate |
Synonyms |
ECK0714, b0726, JW0715, lys, met, lys+met[1] |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
16.34 minutes |
MG1655: 757929..760730 |
||
NC_012967: 739497..742298 |
||||
NC_012759: 660689..663490 |
||||
W3110 |
|
W3110: 759128..761929 |
||
DH10B: 810521..813322 |
||||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
ΔsucA (Keio:JW0715) |
deletion |
deletion |
PMID:16738554 |
||||
ΔsucA::kan |
deletion |
Biolog:respiration |
unable to respire Dextrin |
PMID:16095938 |
|||
ΔsucA::kan |
deletion |
Biolog:respiration |
unable to respire D-Galactose |
PMID:16095938 |
|||
ΔsucA::kan |
deletion |
Biolog:respiration |
unable to respire b-Methyl-D-glucoside |
PMID:16095938 |
|||
ΔsucA::kan |
deletion |
Biolog:respiration |
unable to respire a-D-Glucose-1-phosphate |
PMID:16095938 |
|||
ΔsucA::kan |
deletion |
Biolog:respiration |
unable to respire DL-a-Glycerol |
PMID:16095938 |
|||
ΔsucA::kan |
deletion |
Biolog:respiration |
unable to respire D-Galacturonate |
PMID:16095938 |
|||
ΔsucA::kan |
deletion |
Biolog:respiration |
unable to respire D-Glucuronate |
PMID:16095938 |
|||
ΔsucA::kan |
deletion |
Biolog:respiration |
unable to respire Acetate |
PMID:16095938 |
|||
ΔsucA::kan |
deletion |
Biolog:respiration |
unable to respire a-Hydroxybutyrate |
PMID:16095938 |
|||
ΔsucA::kan |
deletion |
Biolog:respiration |
unable to respire a-Ketobutyrate |
PMID:16095938 |
|||
ΔsucA::kan |
deletion |
Biolog:respiration |
unable to respire a-Ketoglutarate |
PMID:16095938 |
|||
ΔsucA::kan |
deletion |
Biolog:respiration |
unable to respire DL-Lactate |
PMID:16095938 |
|||
ΔsucA::kan |
deletion |
Biolog:respiration |
unable to respire Succinate |
PMID:16095938 |
|||
ΔsucA::kan |
deletion |
Biolog:respiration |
unable to respire Bromosuccinate |
PMID:16095938 |
|||
ΔsucA::kan |
deletion |
Biolog:respiration |
unable to respire Glucuronamide |
PMID:16095938 |
|||
ΔsucA::kan |
deletion |
Biolog:respiration |
unable to respire L-Alanine |
PMID:16095938 |
|||
ΔsucA::kan |
deletion |
Biolog:respiration |
unable to respire L-Alanyl-glycine |
PMID:16095938 |
|||
ΔsucA::kan |
deletion |
Biolog:respiration |
unable to respire L-Asparagine |
PMID:16095938 |
|||
ΔsucA::kan |
deletion |
Biolog:respiration |
unable to respire L-Aspartate |
PMID:16095938 |
|||
ΔsucA::kan |
deletion |
Biolog:respiration |
unable to respire Glycyl-L-aspartate |
PMID:16095938 |
|||
ΔsucA::kan |
deletion |
Biolog:respiration |
unable to respire L-Serine |
PMID:16095938 |
|||
ΔsucA::kan |
deletion |
Biolog:respiration |
unable to respire Uridine |
PMID:16095938 |
|||
sucA8 |
|||||||
ΔsucA775::kan |
PMID:16738554 |
| |||||
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW0715 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCCAGAACAGCGCTTTGAAAGC Primer 2:CCTTCGACGTTCAGCGCGTCATT | |
Kohara Phage |
PMID:3038334 | ||
Kohara Phage |
PMID:3038334 | ||
Linked marker |
est. P1 cotransduction: 6% [5] | ||
Linked marker |
est. P1 cotransduction: 45% [5] | ||
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10979 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10979 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000968 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EchoBASE:EB0972 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0002478 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
Standard name |
SucA |
---|---|
Synonyms |
2-oxoglutarate decarboxylase, thiamin-requiring[1] , ECK0714, JW0715, lys, b0726 |
Product description |
|
EC number (for enzymes) | |
edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
---|---|---|---|---|---|---|---|---|
GO:0005737 |
cytoplasm |
C |
Seeded from Riley et al 2006 [1]. |
Missing: evidence, reference | ||||
GO:0006099 |
tricarboxylic acid cycle |
P |
Seeded from Riley et al 2006 [1]. |
Missing: evidence, reference | ||||
GO:0004591 |
oxoglutarate dehydrogenase (succinyl-transferring) activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR011603 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0004591 |
oxoglutarate dehydrogenase (succinyl-transferring) activity |
GOA:spec |
IEA: Inferred from Electronic Annotation |
EC:1.2.4.2 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005829 |
cytosol |
PMID:16858726 |
IDA: Inferred from Direct Assay |
C |
Seeded from EcoCyc (v14.0) |
complete | ||
GO:0006096 |
glycolysis |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR011603 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006096 |
glycolysis |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0324 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0008152 |
metabolic process |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001017 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016491 |
oxidoreductase activity |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0560 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016624 |
oxidoreductase activity, acting on the aldehyde or oxo group of donors, disulfide as acceptor |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001017 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0030976 |
thiamin pyrophosphate binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR011603 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0055114 |
oxidation reduction |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0560 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
Partner Type | Partner | Notes | References | Evidence |
---|---|---|---|---|
Protein |
hflK |
PMID:15690043 |
Experiment(s):EBI-880717 | |
Protein |
lipA |
PMID:15690043 |
Experiment(s):EBI-880717 | |
Protein |
lpdA |
PMID:15690043 |
Experiment(s):EBI-880717, EBI-886788 | |
Protein |
sucB |
PMID:15690043 |
Experiment(s):EBI-880717, EBI-880739, EBI-886788 | |
Protein |
groL |
PMID:16606699 |
Experiment(s):EBI-1137802 | |
Protein |
dnaE |
PMID:16606699 |
Experiment(s):EBI-1137802 | |
Protein |
oxc |
PMID:16606699 |
Experiment(s):EBI-1137802 | |
Protein |
rplC |
PMID:15690043 |
Experiment(s):EBI-886788 | |
Protein |
lipA |
PMID:19402753 |
MALDI(Z-score):25.667279 | |
Protein |
sucB |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):33.552055 | |
Small Molecule |
TTTPP |
selectively inhibits pyruvate or 2-oxoglutarate dehydrogenase (El). |
| |
edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
Compartment | Description | Evidence | Reference/Source | Notes |
---|---|---|---|---|
edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
Name | |
---|---|
Sequence |
MRITIILVAP ARAENIGAAA RAMKTMGFSD LRIVDSQAHL EPATRWVAHG SGDIIDNIKV FPTLAESLHD VDFTVATTAR SRAKYHYYAT PVELVPLLEE KSSWMSHAAL VFGREDSGLT NEELALADVL TGVPMVADYP SLNLGQAVMV YCYQLATLIQ QPAKSDATAD QHQLQALRER AMTLLTTLAV ADDIKLVDWL QQRLGLLEQR DTAMLHRLLH DIEKNITK |
Length |
228 |
Mol. Wt |
25.259 kDa |
pI |
5.9 (calculated) |
Extinction coefficient |
25,440 - 25,565 (calc based on 6 Y, 3 W, and 1 C residues) |
edit table |
Domains/Motifs/Modification Sites
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
Resource type | Source | Notes/Reference |
---|---|---|
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
ASAP:ABE-0002478 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EcoCyc:EG10979 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10979 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
RegulonDB:ECK120000968 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0972 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
---|---|---|---|---|---|---|---|
Protein |
E. coli K-12 MC4100 |
1.33E+03 |
molecules/cell |
|
emPAI |
PMID:18304323 | |
Protein |
Ecoli K-12 |
158.495+/-0.802 |
Molecules/cell |
|
Single Molecule Fluorescence |
PMID:20671182 | |
mRNA |
Ecoli K-12 |
0.211353088 |
Molecules/cell |
|
by RNA_Seq |
PMID:20671182 | |
Protein |
E. coli K-12 MG1655 |
3431 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
2121 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
2158 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
![]() Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:757909..757949
source=MG1655
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
Allele Name | Mutation | Phenotype | Reference |
---|---|---|---|
edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
Type | Reference | Notes |
---|---|---|
microarray |
NCBI GEO profiles for sucA | |
microarray |
Summary of data for sucA from multiple microarray studies | |
edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
Resource Name | Resource Type | Description | Source | Notes |
---|---|---|---|---|
edit table |
<protect></protect>
Notes
Accessions Related to sucA Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10979 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0972 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10979 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000968 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0002478 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
Organism | Homologs (Statistics) | Comments |
---|---|---|
Shigella flexneri |
SUCA |
From SHIGELLACYC |
E. coli O157 |
SUCA |
From ECOO157CYC |
edit table |
<protect></protect>
Notes
Families
<protect>
See Help:Evolution_families for help entering or editing information in this section of EcoliWiki.
Database | Accession | Notes |
---|---|---|
| ||
edit table |
</protect> <protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 3.0 3.1 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
- ↑ 5.0 5.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
Categories