rpsE:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
rpsE |
|---|---|
| Mnemonic |
Ribosomal protein, small |
| Synonyms |
ECK3290, b3303, JW3265, eps, spc, spcA[1], spcA |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
74.2 minutes, 74.2 minutes |
MG1655: 3443251..3442748 |
||
|
NC_012967: 3373134..3372631 |
||||
|
NC_012759: 3329905..3330408 |
||||
|
W3110 |
|
W3110: 4195187..4195690 |
||
|
DH10B: 3540996..3540493 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
3442751 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
rpsEV21E |
V21E |
(in strain: SPCR7; spectinomycin resistant. Not a ram mutation) |
Strain variation; seeded from UniProt:P0A7W1 | ||||
|
rpsES22P |
S22P |
(in strain: SPCR13 and SPCR15; spectinomycin resistant. Not a ram mutation) |
Strain variation; seeded from UniProt:P0A7W1 | ||||
|
rpsEG104R |
G104R |
(in strain: N-660; suppresses S12 streptomycin dependence) |
Strain variation; seeded from UniProt:P0A7W1 | ||||
|
rpsEE151S |
E151S |
(in strain: B) |
Strain variation; seeded from UniProt:P0A7W1 | ||||
|
rpsER20L |
R20L |
(in strain: SPCR9; spectinomycin resistant. Not a ram mutation) |
Strain variation; seeded from UniProt:P0A7W1 | ||||
|
rpsEEEILGK162G |
EEILGK162G |
(in strain: 0-1; suppresses an alanyl-tRNA synthetase mutation. Blocks ribosome assembly below 25 degrees Celsius) |
Strain variation; seeded from UniProt:P0A7W1 | ||||
|
rpsER112L |
R112L |
(in strain: N-421 and D-1023; suppresses S12 streptomycin-dependence) |
Strain variation; seeded from UniProt:P0A7W1 | ||||
|
rpsER112G |
R112G |
(in strain: NEA-314; neamycin resistant) |
Strain variation; seeded from UniProt:P0A7W1 | ||||
|
rpsER112S |
R112S |
(in strain: NEA-319; neamycin resistant) |
Strain variation; seeded from UniProt:P0A7W1 | ||||
|
rpsERVSKTVKGGR20AVSKTVKGGA |
RVSKTVKGGR20AVSKTVKGGA |
No effect on mRNA unwinding ability of the ribosome |
seeded from UniProt:P0A7W1 | ||||
|
rpsE2300(SpcR) |
spectinomycin resistant |
||||||
|
rpsE2113(SpcR) |
spectinomycin resistant |
||||||
|
rpsE2018 |
|||||||
|
rpsE2339(SpcR) |
spectinomycin resistant |
||||||
|
rpsE2015(SpcR) |
spectinomycin resistant |
||||||
|
rpsE2111(SpcR) |
spectinomycin resistant |
||||||
|
rpsE2128(SpcR) |
spectinomycin resistant |
||||||
|
rpsE2130(SpcR) |
spectinomycin resistant |
||||||
|
rpsE116(SpcR) |
spectinomycin resistant |
||||||
|
rpsE2115(SpcR) |
spectinomycin resistant |
||||||
|
rpsE2112(SpcR) |
spectinomycin resistant |
||||||
|
rpsE2123(SpcR) |
spectinomycin resistant |
||||||
|
rpsE2126(SpcR) |
spectinomycin resistant |
||||||
|
rpsE2296(SpcR) |
spectinomycin resistant |
||||||
|
rpsE2127(SpcR) |
spectinomycin resistant |
||||||
|
rpsE2117(SpcR) |
spectinomycin resistant |
||||||
|
rpsE11(SpcR) |
spectinomycin resistant |
||||||
|
rpsE0(SpcR) |
spectinomycin resistant |
||||||
|
rpsE2154 |
|||||||
|
rpsE2141 |
|||||||
|
rpsE-nea314 rpsL-nea314 |
Resistant to |
resistance to neamine |
See Figure 7 for analysis of the Double mutation | ||||
|
spcA strA |
Resistant to |
Resistance to Neamine |
Strain: KMBL-146 |
Table 4 results are traceable references here [5] | |||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3265 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGCTCACATCGAAAAACAAGC Primer 2:CCTTTCCCCAGAATTTCTTCAAC | |
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 61% [10] | ||
|
Linked marker |
est. P1 cotransduction: 4% [10] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Wittmann-Liebold, B & Greuer, B (1978) The primary structure of protein S5 from the small subunit of the Escherichia coli ribosome. FEBS Lett. 95 91-8 PubMed
- ↑ Brown, ME & Apirion, D (1974) Mapping a cluster of ribosomal genes in Escherichia coli. Mol. Gen. Genet. 133 317-27 PubMed
- ↑ 4.0 4.1 Yaguchi, M et al. (1975) Cooperative control of translational fidelity by ribosomal proteins in Escherichia coli. II. Localization of amino acid replacements in proteins S5 and S12 altered in double mutants resistant to neamine. Mol. Gen. Genet. 142 35-43 PubMed
- ↑ 5.0 5.1 De Wilde, M et al. (1975) Cooperative control of translation fidelity by ribosomal proteins in Escherichia coli. I. Properties of ribosomal mutants whose resistance to neamine is the cumulative effect of two distinct mutations. Mol. Gen. Genet. 142 19-33 PubMed
- ↑ Bailey, L et al. (1976) An iridovirus from bees. J. Gen. Virol. 31 459-61 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 9.0 9.1 CGSC: The Coli Genetics Stock Center
- ↑ 10.0 10.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
