rpsC:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
rpsC |
|---|---|
| Mnemonic |
Ribosomal protein, small |
| Synonyms |
ECK3301, b3314, JW3276[1], JW3276 |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
74.3 minutes, 74.3 minutes |
MG1655: 3447905..3447204 |
||
|
NC_012967: 3377788..3377087 |
||||
|
NC_012759: 3334361..3335062 |
||||
|
W3110 |
|
W3110: 4190533..4191234 |
||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
3447207 |
Edman degradation |
| ||
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
rpsCRRAMK131AAAMA |
RRAMK131AAAMA |
Decreases mRNA unwinding ability of the ribosome |
seeded from UniProt:P0A7V3 | ||||
|
rpsC in HN13 |
sprr received by P1 transduction |
Sensitivity to |
there was a decrease in cold sensitivity but a continuation in spc resistance. |
See Figure 1. This is ultimately a derivative of AB1157 1157 | |||
|
Sucd-Spcr in YM50 |
Ribosomal Alteration |
Protein Deletion |
Protein I-19 was deleted |
See Table 2. Also absent in strains YM22, YM26, YM37, YM54, YM69, YM84, YM85, YM93, YM101 | |||
|
Sucd-Spcr in YM101 |
Ribosomal Alteration |
Protein Deletion |
Protein I-13 was deleted |
See Table 2 and Figure 1 | |||
|
I-19 in W4626Phe- |
100 ug of chloramphenicol was added 10 minutes prior to the addition of spectinomycin |
Rate of protien synthesis |
the addition of chloramphenicol caused a delay in the disappearance of I-19 as seen in Figure 7 A to D. |
Cell growth was greatly inhibited as seen in Figure 6 curve II but not completely stopped. | |||
|
Sucd-Spcr in YM22 |
Ribosomal Alteration |
Protein Deletion |
Protein I-24 was deleted |
See Table 2. Also absent in strains YM50 and YM93 | |||
|
I-19 in W4626Phe- |
300 ug of chloramiphenicol was added before the addition of spectinomycin |
Rate of protien synthesis |
the addition of chloramphenicol stopped the disappearance of I-19, see figure 7E |
Cell growth was greatly inhibited as seen in Figure 6 curve III | |||
| edit table |
Notes
Genetic Interactions
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3276 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGGTCAGAAAGTACATCCTAA Primer 2:CCTTTACGaCCTTTACGCTGCTGCTTTTTA | |
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 51% [9] | ||
|
Linked marker |
est. P1 cotransduction: 6% [9] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Brauer, D & Röming, R (1979) The primary structure of protein S3 from the small ribosomal subunit of Escherichia coli. FEBS Lett. 106 352-7 PubMed
- ↑ Sullivan, JJ et al. (1977) Purification and properties of the pyrrolidonecarboxylate peptidase of Streptococcus faecium. Aust. J. Biol. Sci. 30 543-52 PubMed
- ↑ 4.0 4.1 4.2 Mizuno, T et al. (1976) Coordinated alterations in ribosomes and cytoplasmic membrane in sucrose-dependent, spectinomycin-resistant mutants of Escherichia coli. J. Bacteriol. 125 524-30 PubMed
- ↑ 5.0 5.1 Mizuno, T et al. (1977) Interaction of cytoplasmic membrane and ribosomes in Escherichia coli: spectinomycin-induced disappearance of membrane protein I-19. J. Bacteriol. 129 326-32 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 8.0 8.1 CGSC: The Coli Genetics Stock Center
- ↑ 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).