rpoE:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
| Standard Name |
rpoE |
|---|---|
| Gene Synonym(s) |
ECK2571, b2573, JW2557, sigE[1], sigE |
| Product Desc. |
sigmaE[2]; RNA polymerase, sigma 24 (sigma E) factor[3]; Component of RNA polymerase sigma 24[2][3] RNA polymerase subunit, extracytoplasmic stress sigma E; role in high temperature and oxidative stress response[4] |
| Product Synonyms(s) |
RNA polymerase, sigma 24 (sigma E) factor[1], B2573[2][1], SigE[2][1], RpoE[2][1], sigma E factor[2][1], sigma24 factor[2][1], sigma 24 factor[3][1] , ECK2571, JW2557, sigE, b2573 |
| Function from GO |
<GO_nr /> |
| Knock-Out Phenotype | |
| Regulation/Expression |
transcription unit(s): rpoE-rseABC[2] |
| Regulation/Activity | |
| Quick Links | |
| edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
rpoE is transiently induced after a cold shock, dependent on the presence of PNPase. Induced by, and increases resistance to, Cd(II), Zn(II) and Cu(II). rpoE is an essential gene that can be disrupted only in the presence of unlinked suppressor mutations, e.g. ydcQ (De Las Penas, 1997, Button, 2006).[4]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
rpoE |
|---|---|
| Mnemonic |
RNA polymerase |
| Synonyms |
ECK2571, b2573, JW2557, sigE[1], sigE |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
58.35 minutes |
MG1655: 2708034..2707459 |
||
|
NC_012967: 2631505..2630930 |
||||
|
NC_012759: 2593264..2593839 |
||||
|
W3110 |
|
W3110: 2708668..2708093 |
||
|
DH10B: 2799799..2799224 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
rpoEL25P |
L25P |
(in rpoE-25; loss of activity) |
Strain variation; seeded from UniProt:P0AGB6 | ||||
|
rpoES172P |
S172P |
(in rpoE-172; loss of activity) |
Strain variation; seeded from UniProt:P0AGB6 | ||||
|
rpoER178G |
R178G |
(in rpoE-178; loss of activity) |
Strain variation; seeded from UniProt:P0AGB6 | ||||
|
rpoE(del) |
deletion |
Change in the expression of a gene |
An increase in the expression of rybB gene |
PMID:17416652 |
See figure 3B | ||
|
rpoE2072::Tn10dCam |
Insertion |
Mutagenesis Rate |
Decrease of Stress Induced Mutagenesis (SIM). |
PMID:23224554 |
Parent Strain: SMR4562 Experimental Strain: SMR5236 |
The mutation conferred a strong reduction SIM, with mutant frequency being decreased by over 90 percent. See Table S3 for full experimental data. | |
|
rpoE2072::Tn10dCam |
Insertion |
Sensitivity to |
SDS-EDTA Sensitivity |
PMID:23224554 |
Parent Strain: SMR4562 Experimental Strain: SMR5236 |
The mutation conferred an increase in SDS-EDTA sensitivity. See table S7 and S1 for a summary of Experimental Data. | |
|
CAG45114 rpoE2072::Tn10dCam |
Insertion |
SigmaE activity |
Decrease in SigmaE activity |
PMID:23224554 |
Parental Strain: CAG45114 Experimental Strain:SMR15311 |
See table S11 for full experimental results. | |
| edit table |
<protect></protect>
Notes
PEC shows rpoE as nonessential, but it is essential[5].
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2557 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCAGCGAGCAGTTAACGGACCA Primer 2:CCACGCCTGATAAGCGGTTGAAC | |
|
Kohara Phage |
PMID:3038334 | ||
|
Linked marker |
est. P1 cotransduction: 14% [7] | ||
|
Linked marker |
est. P1 cotransduction: 93% [7] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG11897 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG11897 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120001827 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EchoBASE:EB1843 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0008467 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
RpoE |
|---|---|
| Synonyms |
RNA polymerase, sigma 24 (sigma E) factor[1], B2573[2][1], SigE[2][1], RpoE[2][1], sigma E factor[2][1], sigma24 factor[2][1], sigma 24 factor[3][1] , ECK2571, JW2557, sigE, b2573 |
| Product description |
sigmaE[2]; RNA polymerase, sigma 24 (sigma E) factor[3]; Component of RNA polymerase sigma 24[2][3] RNA polymerase subunit, extracytoplasmic stress sigma E; role in high temperature and oxidative stress response[4] |
| EC number (for enzymes) |
|
| edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
|
GO:0003677 |
DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000838 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003677 |
DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR007627 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003677 |
DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR013249 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003677 |
DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR013324 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003677 |
DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR013325 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003677 |
DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR014284 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003677 |
DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR014286 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003677 |
DNA binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0238 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003700 |
transcription factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000838 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003700 |
transcription factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR007627 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003700 |
transcription factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR013249 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003700 |
transcription factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR013324 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003700 |
transcription factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR013325 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003700 |
transcription factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR014284 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003700 |
transcription factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR014286 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006350 |
transcription |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0804 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006352 |
transcription initiation |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000838 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006352 |
transcription initiation |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR007627 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006352 |
transcription initiation |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR013249 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006352 |
transcription initiation |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR013324 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006352 |
transcription initiation |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR013325 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006352 |
transcription initiation |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR014284 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006352 |
transcription initiation |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR014286 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006355 |
regulation of transcription, DNA-dependent |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000838 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006355 |
regulation of transcription, DNA-dependent |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR007627 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006355 |
regulation of transcription, DNA-dependent |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR013249 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006355 |
regulation of transcription, DNA-dependent |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR013324 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006355 |
regulation of transcription, DNA-dependent |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR013325 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006355 |
regulation of transcription, DNA-dependent |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR014284 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006355 |
regulation of transcription, DNA-dependent |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR014286 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006355 |
regulation of transcription, DNA-dependent |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0731 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006950 |
response to stress |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0346 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016987 |
sigma factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000838 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016987 |
sigma factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR007627 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016987 |
sigma factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR013249 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016987 |
sigma factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR013324 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016987 |
sigma factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR013325 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016987 |
sigma factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR014284 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016987 |
sigma factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR014286 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016987 |
sigma factor activity |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0731 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
| edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
|
Protein |
Subunits of RNA polymerase sigma 24 |
could be indirect |
||
|
Protein |
rcsA |
PMID:16606699 |
Experiment(s):EBI-1143317 | |
|
Protein |
cheZ |
PMID:16606699 |
Experiment(s):EBI-1143317 | |
|
Protein |
rpsD |
PMID:16606699 |
Experiment(s):EBI-1143317 | |
|
Protein |
glpD |
PMID:16606699 |
Experiment(s):EBI-1143317 | |
|
Protein |
rpoC |
PMID:16606699 |
Experiment(s):EBI-1143317 | |
|
Protein |
yggG |
PMID:16606699 |
Experiment(s):EBI-1143317 | |
|
Protein |
dnaB |
PMID:16606699 |
Experiment(s):EBI-1143317 | |
|
Protein |
yfbU |
PMID:16606699 |
Experiment(s):EBI-1143317 | |
|
Protein |
yjjK |
PMID:16606699 |
Experiment(s):EBI-1143317 | |
|
Protein |
rplQ |
PMID:16606699 |
Experiment(s):EBI-1143317 | |
|
Protein |
ygeR |
PMID:16606699 |
Experiment(s):EBI-1143317 | |
|
Protein |
btuD |
PMID:16606699 |
Experiment(s):EBI-1143317 | |
|
Protein |
rpoB |
PMID:16606699 |
Experiment(s):EBI-1143317 | |
| edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Reference/Source | Notes |
|---|---|---|---|---|
|
Cytoplasm |
PMID:15774872, PMID:16597971, PMID:11777003 |
|||
|
cytoplasm |
From EcoCyc[3] |
| ||
| edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Name | |
|---|---|
| Sequence |
MSEQLTDQVL VERVQKGDQK AFNLLVVRYQ HKVASLVSRY VPSGDVPDVV QEAFIKAYRA LDSFRGDSAF YTWLYRIAVN TAKNYLVAQG RRPPSSDVDA IEAENFESGG ALKEISNPEN LMLSEELRQI VFRTIESLPE DLRMAITLRE LDGLSYEEIA AIMDCPVGTV RSRIFRAREA IDNKVQPLIR R |
| Length |
191 |
| Mol. Wt |
21.695 kDa |
| pI |
5.3 (calculated) |
| Extinction coefficient |
15,930 - 16,055 (calc based on 7 Y, 1 W, and 1 C residues) |
| edit table |
Domains/Motifs/Modification Sites
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
|
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
ASAP:ABE-0008467 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EcoCyc:EG11897 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG11897 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
RegulonDB:ECK120001827 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB1843 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|
|
Protein |
E. coli K-12 MC4100 |
2.29E+02 |
molecules/cell |
|
emPAI |
PMID:18304323 | |
|
Protein |
E. coli K-12 MG1655 |
532 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
212 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
504 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
| edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:2708014..2708054
source=MG1655
flip=1
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for rpoE | |
|
microarray |
Summary of data for rpoE from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
|
GFP Fusion |
Intergenic region (2707932..2708492) fused to gfpmut2. |
GFP fusion described in Zaslaver, et al. | ||
| edit table |
<protect></protect>
Notes
Accessions Related to rpoE Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG11897 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB1843 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG11897 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120001827 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0008467 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Anopheles gambiae |
|
From Inparanoid:20070104 |
|
Shigella flexneri |
RPOE |
From SHIGELLACYC |
|
E. coli O157 |
RPOE |
From ECOO157CYC |
| edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG11897 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG11897 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120001827 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB1843 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0008467 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 3.3 3.4 3.5 3.6 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ De Las Peñas, A et al. (1997) SigmaE is an essential sigma factor in Escherichia coli. J. Bacteriol. 179 6862-4 PubMed
- ↑ 6.0 6.1 CGSC: The Coli Genetics Stock Center
- ↑ 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed
Categories


