rpoE:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
rpoE |
|---|---|
| Mnemonic |
RNA polymerase |
| Synonyms |
ECK2571, b2573, JW2557, sigE[1], sigE |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
58.35 minutes |
MG1655: 2708034..2707459 |
||
|
NC_012967: 2631505..2630930 |
||||
|
NC_012759: 2593264..2593839 |
||||
|
W3110 |
|
W3110: 2708668..2708093 |
||
|
DH10B: 2799799..2799224 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
rpoEL25P |
L25P |
(in rpoE-25; loss of activity) |
Strain variation; seeded from UniProt:P0AGB6 | ||||
|
rpoES172P |
S172P |
(in rpoE-172; loss of activity) |
Strain variation; seeded from UniProt:P0AGB6 | ||||
|
rpoER178G |
R178G |
(in rpoE-178; loss of activity) |
Strain variation; seeded from UniProt:P0AGB6 | ||||
|
rpoE(del) |
deletion |
Change in the expression of a gene |
An increase in the expression of rybB gene |
See figure 3B | |||
|
rpoE2072::Tn10dCam |
Insertion |
Mutagenesis Rate |
Decrease of Stress Induced Mutagenesis (SIM). |
Parent Strain: SMR4562 Experimental Strain: SMR5236 |
The mutation conferred a strong reduction SIM, with mutant frequency being decreased by over 90 percent. See Table S3 for full experimental data. | ||
|
rpoE2072::Tn10dCam |
Insertion |
Sensitivity to |
SDS-EDTA Sensitivity |
Parent Strain: SMR4562 Experimental Strain: SMR5236 |
The mutation conferred an increase in SDS-EDTA sensitivity. See table S7 and S1 for a summary of Experimental Data. | ||
|
CAG45114 rpoE2072::Tn10dCam |
Insertion |
SigmaE activity |
Decrease in SigmaE activity |
Parental Strain: CAG45114 Experimental Strain:SMR15311 |
See table S11 for full experimental results. | ||
| edit table |
<protect></protect>
Notes
PEC shows rpoE as nonessential, but it is essential[4].
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2557 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAGCGAGCAGTTAACGGACCA Primer 2:CCACGCCTGATAAGCGGTTGAAC | |
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 14% [8] | ||
|
Linked marker |
est. P1 cotransduction: 93% [8] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Thompson, KM et al. (2007) SigmaE regulates and is regulated by a small RNA in Escherichia coli. J. Bacteriol. 189 4243-56 PubMed
- ↑ 3.0 3.1 3.2 Al Mamun, AA et al. (2012) Identity and function of a large gene network underlying mutagenic repair of DNA breaks. Science 338 1344-8 PubMed
- ↑ De Las Peñas, A et al. (1997) SigmaE is an essential sigma factor in Escherichia coli. J. Bacteriol. 179 6862-4 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 7.0 7.1 CGSC: The Coli Genetics Stock Center
- ↑ 8.0 8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).