rplL:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
rplL |
|---|---|
| Mnemonic |
Ribosomal protein, large |
| Synonyms |
ECK3977, b3986, JW3949[1], JW3949 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
90.06 minutes, 90.06 minutes |
MG1655: 4178583..4178948 |
||
|
NC_012967: 4160171..4160536 |
||||
|
NC_012759: 4068263..4068628 |
||||
|
W3110 |
|
W3110: 3456121..3455756 |
||
|
DH10B: 4278279..4278644 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
4178586 |
Edman degradation |
PMID:773698[2] |
| |
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3949 |
Plasmid clone |
Status:Clone OK Primer 1:GCCTCTATCACTAAAGATCAAAT Primer 2:CCTTTAACTTCAACTTCAGCGCC | |
|
Linked marker |
est. P1 cotransduction: 37% [10] | ||
|
Linked marker |
est. P1 cotransduction: 57% [10] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Pettersson, I et al. (1976) The ribosomal protein L8 is a complex L7/L12 and L10. FEBS Lett. 64 135-8 PubMed
- ↑ Terhorst, C et al. (1973) The primary structure of an acidic protein from 50-S ribosomes of Escherichia coli which is involved in GTP hydrolysis dependent on elongation factors G and T. Eur. J. Biochem. 34 138-52 PubMed
- ↑ Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed
- ↑ Wilkins, MR et al. (1998) Protein identification with N and C-terminal sequence tags in proteome projects. J. Mol. Biol. 278 599-608 PubMed
- ↑ Wasinger, VC & Humphery-Smith, I (1998) Small genes/gene-products in Escherichia coli K-12. FEMS Microbiol. Lett. 169 375-82 PubMed
- ↑ Hoving, S et al. (2000) A method for the chemical generation of N-terminal peptide sequence tags for rapid protein identification. Anal. Chem. 72 1006-14 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 9.0 9.1 CGSC: The Coli Genetics Stock Center
- ↑ 10.0 10.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).