{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	rluB
Gene Synonym(s)	ECK1263, b1269, JW1261, yciL^[1], yciL
Product Desc.	23S rRNA pseudouridine synthase^[2]^[3] 23S rRNA U2605 pseudouridine synthase^[4]
Product Synonyms(s)	23S rRNA pseudouridylate synthase^[1], B1269^[2]^[1], RluB^[2]^[1], YciL^[2]^[1] , ECK1263, JW1261, yciL, b1269
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): rluB^[2]
Regulation/Activity
Quick Links
edit table

See Help:Quickview for help with entering information in the Quickview table.

Notes

[back to top]

Ribosome-associated protein (Jiang, 2007).^[4]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	rluB
Mnemonic	rRNA, large, uridine
Synonyms	ECK1263, b1269, JW1261, yciL^[1], yciL
edit table

Notes

Location(s) and DNA Sequence

[back to top]

See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	28.56 minutes	MG1655: 1324876..1325751 <gbrowseImage> name=NC_000913:1324876..1325751 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 1325224..1326099 <gbrowseImage> name=NC_012967:1325224..1326099 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 1215725..1216600 <gbrowseImage> name=NC_012759:1215725..1216600 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 1328566..1329441 <gbrowseImage> name=NC_007779:1328566..1329441 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 1414272..1415147 <gbrowseImage> name=NC_010473:1414272..1415147 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Description	Reference	Availability	Comments
ΔrluB (Keio:JW1261)	deletion	deletion		PMID:16738554	Shigen CGSC9136^[5]
rluBD110N,T		D110N,T	Loss of activity			seeded from UniProt:P37765
ΔrluB777::kan				PMID:16738554	CGSC:102732
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW1261	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCAGCGAAAAGCTACAGAAAGT Primer 2:CCACCGTTATTATTACGTCCGCC
4F1	Kohara Phage	Genobase	PMID:3038334
13F9	Kohara Phage	Genobase	PMID:3038334
trpC83::Tn10	Linked marker	CAG18455 = CGSC7371^[5]	est. P1 cotransduction: 78% ^[6] Synonyms:trpB83::Tn10
zcj-233::Tn10	Linked marker	CAG12028 = CGSC7373^[5]	est. P1 cotransduction: 15% ^[6] Synonyms:zci-233::Tn10
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG12433	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG12433	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120002288	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:945840	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB2329	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0004259	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	RluB
Synonyms	23S rRNA pseudouridylate synthase^[1], B1269^[2]^[1], RluB^[2]^[1], YciL^[2]^[1] , ECK1263, JW1261, yciL, b1269
Product description	23S rRNA pseudouridine synthase^[2]^[3] 23S rRNA U2605 pseudouridine synthase^[4]
EC number (for enzymes)	4.2.1.70^[1]
edit table

Notes

Function

[back to top]

Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0005737	cytoplasm				C	Seeded from Riley et al 2006 ^[1].	Missing: evidence, reference
	GO:0003723	RNA binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000748	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003723	RNA binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR002942	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003723	RNA binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR006145	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003723	RNA binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR018496	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003723	RNA binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR020103	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003723	RNA binding	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0694	F	Seeded from EcoCyc (v14.0)	complete
	GO:0009982	pseudouridine synthase activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR006145	F	Seeded from EcoCyc (v14.0)	complete
	GO:0009982	pseudouridine synthase activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR020103	F	Seeded from EcoCyc (v14.0)	complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	References	Evidence
Protein	rplC	PMID:15690043^[7]	Experiment(s):EBI-878697, EBI-889536
Protein	rplD	PMID:15690043^[7]	Experiment(s):EBI-878697
Protein	rplE	PMID:15690043^[7]	Experiment(s):EBI-878697
Protein	rplF	PMID:15690043^[7]	Experiment(s):EBI-878697
Protein	rplI	PMID:15690043^[7]	Experiment(s):EBI-878697, EBI-889536
Protein	rplM	PMID:15690043^[7]	Experiment(s):EBI-878697, EBI-889536
Protein	rpsA	PMID:15690043^[7]	Experiment(s):EBI-878697, EBI-889536
Protein	rpsB	PMID:15690043^[7]	Experiment(s):EBI-878697
Protein	rpsC	PMID:15690043^[7]	Experiment(s):EBI-878697
Protein	rpsD	PMID:15690043^[7]	Experiment(s):EBI-878697
Protein	rpsE	PMID:15690043^[7]	Experiment(s):EBI-878697, EBI-889536
Protein	rpsG	PMID:15690043^[7]	Experiment(s):EBI-878697, EBI-889536
Protein	rpsJ	PMID:15690043^[7]	Experiment(s):EBI-878697, EBI-889536
Protein	rpsM	PMID:15690043^[7]	Experiment(s):EBI-878697
Protein	srmB	PMID:15690043^[7]	Experiment(s):EBI-878697, EBI-889906, EBI-889536
Protein	rnr	PMID:15690043^[7]	Experiment(s):EBI-878697, EBI-889536
Protein	ybhF	PMID:15690043^[7]	Experiment(s):EBI-878697
Protein	ycbY	PMID:15690043^[7]	Experiment(s):EBI-878697
Protein	ygiF	PMID:15690043^[7]	Experiment(s):EBI-878697, EBI-889536
Protein	yhiR	PMID:15690043^[7]	Experiment(s):EBI-878697, EBI-889536
Protein	aceE	PMID:15690043^[7]	Experiment(s):EBI-878697
Protein	aidB	PMID:15690043^[7]	Experiment(s):EBI-878697
Protein	hrpA	PMID:15690043^[7]	Experiment(s):EBI-878697, EBI-889536
Protein	pssA	PMID:15690043^[7]	Experiment(s):EBI-878697
Protein	rplA	PMID:15690043^[7]	Experiment(s):EBI-878697, EBI-889536
Protein	rplB	PMID:15690043^[7]	Experiment(s):EBI-878697
Protein	pnp	PMID:15690043^[7]	Experiment(s):EBI-878697, EBI-883913
Protein	yciK	PMID:16606699^[8]	Experiment(s):EBI-1139392
Protein	rplD	PMID:16606699^[8]	Experiment(s):EBI-1139392
Protein	trpH	PMID:16606699^[8]	Experiment(s):EBI-1139392
Protein	matC	PMID:16606699^[8]	Experiment(s):EBI-1139392
Protein	yhcA	PMID:16606699^[8]	Experiment(s):EBI-1139392
Protein	alaS	PMID:15690043^[7]	Experiment(s):EBI-889536
Protein	rplS	PMID:15690043^[7]	Experiment(s):EBI-889536
Protein	rplU	PMID:15690043^[7]	Experiment(s):EBI-889536
Protein	rplV	PMID:15690043^[7]	Experiment(s):EBI-889536
Protein	rplX	PMID:15690043^[7]	Experiment(s):EBI-889536
Protein	rplY	PMID:15690043^[7]	Experiment(s):EBI-889536
Protein	rpmB	PMID:15690043^[7]	Experiment(s):EBI-889536
Protein	rpsF	PMID:15690043^[7]	Experiment(s):EBI-889536
Protein	rpsN	PMID:15690043^[7]	Experiment(s):EBI-889536
Protein	rpsP	PMID:15690043^[7]	Experiment(s):EBI-889536
Protein	rpsR	PMID:15690043^[7]	Experiment(s):EBI-889536
Protein	rpsU	PMID:15690043^[7]	Experiment(s):EBI-889536
Protein	yhbP	PMID:15690043^[7]	Experiment(s):EBI-889536
Protein	yhiN	PMID:15690043^[7]	Experiment(s):EBI-889536
Protein	yibL	PMID:15690043^[7]	Experiment(s):EBI-889536
Protein	rluE	PMID:15690043^[7]	Experiment(s):EBI-889536
Protein	rpsT	PMID:15690043^[7]	Experiment(s):EBI-889536
Protein	alaS	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	rpsJ	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):10.392078
Protein	rpmB	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	rpsN	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	hupA	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):8.532802
Protein	rpsP	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	rplY	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	rplS	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):14.060385
Protein	hupB	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	rpsT	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	rplU	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	rpsF	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	rplP	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):2.924285
Protein	rpsM	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):13.939772
Protein	rpsA	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):23.063409
Protein	rplM	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):26.375559
Protein	rpsS	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	rplI	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):27.796292
Protein	rpsC	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):39.720713
Protein	rplE	PMID:19402753^[9]	MALDI(Z-score):24.175743
Protein	rplA	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):49.687349
Protein	ihfA	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	rpsD	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):33.716981
Protein	malP	PMID:19402753^[9]	MALDI(Z-score):25.062476
Protein	rplX	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):9.289736
Protein	rplB	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):38.386342
Protein	yhiN	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	rplT	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	rpsR	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	rplO	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):9.822047
Protein	rplD	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):11.464963
Protein	rplR	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	rpsU	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	yhbY	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):29.921344
Protein	rplF	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):21.056102
Protein	yeeX	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):27.920160
Protein	rplQ	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):8.078623
Protein	yihI	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	infC	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):9.079176
Protein	ygiF	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):38.545635
Protein	aidB	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):7.165941
Protein	yfiF	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):39.439746
Protein	hfq	PMID:19402753^[9]	LCMS(ID Probability):91.3 MALDI(Z-score):34.025282
Protein	srmB	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):27.618726
Protein	ybcJ	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):36.425657
Protein	rnr	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):28.384439
Protein	pssA	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):27.564573
Protein	yhbP	PMID:19402753^[9]	LCMS(ID Probability):99.6
Protein	dapF	PMID:19402753^[9]	LCMS(ID Probability):99.0 MALDI(Z-score):4.519301
Protein	hrpA	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):18.667898
Protein	yibL	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):11.691034
Protein	rlmL	PMID:19402753^[9]	MALDI(Z-score):29.013329
Protein	rluC	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):38.535535
Protein	yhiR	PMID:19402753^[9]	LCMS(ID Probability):99.6 MALDI(Z-score):39.378168
Protein	rluE	PMID:19402753^[9]	LCMS(ID Probability):99.6
edit table

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source	Notes
edit table

Notes

Structure and Physical Properties

[back to top]

Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MSEKLQKVLA RAGHGSRREI ESIIEAGRVS VDGKIAKLGD RVEVTPGLKI RIDGHLISVR ESAEQICRVL AYYKPEGELC TRNDPEGRPT VFDRLPKLRG ARWIAVGRLD VNTCGLLLFT TDGELANRLM HPSREVEREY AVRVFGQVDD AKLRDLSRGV QLEDGPAAFK TIKFSGGEGI NQWYNVTLTE GRNREVRRLW EAVGVQVSRL IRVRYGDIPL PKGLPRGGWT ELDLAQTNYL RELVELPPET SSKVAVEKDR RRMKANQIRR AVKRHSQVSG GRRSGGRNNN G
Length	291
Mol. Wt	32.711 kDa
pI	10.4 (calculated)
Extinction coefficient	30,940 - 31,315 (calc based on 6 Y, 4 W, and 3 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	References
Domain	3..57	PF01479 S4 domain	PMID:19920124^[10]
Domain	68..202	PF00849 RNA pseudouridylate synthase	PMID:19920124^[10]
edit table

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=rluB taxon=562,83333 </beststructure>

Models

View models at:

edit table

Structure figures

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16129230	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:945840	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0004259	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P37765	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:EG12433	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG12433	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:945840	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120002288	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB2329	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Notes	Reference(s)
Protein	E. coli K-12 MC4100	3.68E+02	molecules/cell	Medium: median data from rich and minimal media Temperature (°C): 37 Doubling time (min): Growth Rate(min): Growth phase: other:	emPAI		PMID:18304323
Protein	Ecoli K-12	51.674+/-0.303	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		Single Molecule Fluorescence	PMID:20671182
Protein	E. coli K-12 MG1655	6949	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	899	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	3224	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
rluB
edit table

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<gbrowseImage> name=NC_000913:1324856..1324896 source=MG1655 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b1269 (EcoliWiki Page)	NCBI GEO profiles for rluB
microarray	GenExpDB:b1269 (EcoliWiki Page)	Summary of data for rluB from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
	GFP Fusion	Intergenic region (1324571..1324948) fused to gfpmut2.	OpenBioSystems	GFP fusion described in Zaslaver, et al. Plate:109-AZ14; Well:F5^[11]
edit table

Notes

Accessions Related to rluB Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG12433	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB2329	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b1269
EcoGene	EcoGene:EG12433	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120002288	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0004259	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Dictyostelium discoideum	DDB0167086 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Shigella flexneri	YCIL	From SHIGELLACYC
E. coli O157	YCIL	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Pfam (EcoliWiki Page)	PF01479 S4 domain
Panther (EcoliWiki Page)	PTHR21600:SF2
Superfamily (EcoliWiki Page)	SUPERFAMILY:55120
Superfamily (EcoliWiki Page)	SUPERFAMILY:55174
Pfam (EcoliWiki Page)	PF00849 RNA pseudouridylate synthase
EcoCyc	EcoCyc:EG12433	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG12433	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120002288	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB2329	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0004259	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.00 ^1.01 ^1.02 ^1.03 ^1.04 ^1.05 ^1.06 ^1.07 ^1.08 ^1.09 ^1.10 ^1.11 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.0 ^2.1 ^2.2 ^2.3 ^2.4 ^2.5 ^2.6 ^2.7 ^2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.0 ^3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 ^4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ ^5.0 ^5.1 ^5.2 CGSC: The Coli Genetics Stock Center
↑ ^6.0 ^6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
↑ ^7.00 ^7.01 ^7.02 ^7.03 ^7.04 ^7.05 ^7.06 ^7.07 ^7.08 ^7.09 ^7.10 ^7.11 ^7.12 ^7.13 ^7.14 ^7.15 ^7.16 ^7.17 ^7.18 ^7.19 ^7.20 ^7.21 ^7.22 ^7.23 ^7.24 ^7.25 ^7.26 ^7.27 ^7.28 ^7.29 ^7.30 ^7.31 ^7.32 ^7.33 ^7.34 ^7.35 ^7.36 ^7.37 ^7.38 ^7.39 ^7.40 ^7.41 ^7.42 ^7.43 Butland, G et al. (2005) Interaction network containing conserved and essential protein complexes in Escherichia coli. Nature 433 531-7 PubMed
↑ ^8.0 ^8.1 ^8.2 ^8.3 ^8.4 Arifuzzaman, M et al. (2006) Large-scale identification of protein-protein interaction of Escherichia coli K-12. Genome Res. 16 686-91 PubMed
↑ ^9.00 ^9.01 ^9.02 ^9.03 ^9.04 ^9.05 ^9.06 ^9.07 ^9.08 ^9.09 ^9.10 ^9.11 ^9.12 ^9.13 ^9.14 ^9.15 ^9.16 ^9.17 ^9.18 ^9.19 ^9.20 ^9.21 ^9.22 ^9.23 ^9.24 ^9.25 ^9.26 ^9.27 ^9.28 ^9.29 ^9.30 ^9.31 ^9.32 ^9.33 ^9.34 ^9.35 ^9.36 ^9.37 ^9.38 ^9.39 ^9.40 ^9.41 ^9.42 ^9.43 ^9.44 ^9.45 ^9.46 ^9.47 ^9.48 ^9.49 ^9.50 ^9.51 ^9.52 ^9.53 ^9.54 Hu, P et al. (2009) Global functional atlas of Escherichia coli encompassing previously uncharacterized proteins. PLoS Biol. 7 e96 PubMed
↑ ^10.0 ^10.1 Finn, RD et al. (2010) The Pfam protein families database. Nucleic Acids Res. 38 D211-22 PubMed
↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed

rluB:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to rluB Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search