{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	rlmE
Gene Synonym(s)	ECK3168, b3179, JW3146, ftsJ, mrsF, rrmJ^[1], mrsF, rrmJ
Product Desc.	23S rRNA m2U2552 methyltransferase^[2]^[3] 23S rRNA U2552 ribose 2'-O-methyltransferase, SAM-dependent; involved in cell division and growth; heat inducible; suppresssed by cloned ObgE and Der^[4]
Product Synonyms(s)	23S rRNA methyltransferase^[1], B3179^[2]^[1], RrmJ^[2]^[1], MrsF^[2]^[1], FtsJ^[2]^[1] , ECK3168, ftsJ, JW3146, mrsF, rrmJ, b3179
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): rlmE-hflB^[2]
Regulation/Activity
Quick Links
edit table

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	rlmE
Mnemonic	rRNA large-subunit methylation
Synonyms	ECK3168, b3179, JW3146, ftsJ, mrsF, rrmJ^[1], mrsF, rrmJ
edit table

</protect>

Notes

Location(s) and DNA Sequence

[back to top]

<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	71.67 minutes	MG1655: 3325686..3325057 <gbrowseImage> name=NC_000913:3325057..3325686 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
BW2952		NC_012759: 3212205..3212834 <gbrowseImage> name=NC_012759:3212205..3212834 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 3327519..3326890 <gbrowseImage> name=NC_007779:3326890..3327519 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 3423431..3422802 <gbrowseImage> name=NC_010473:3422802..3423431 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

</protect>

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Type	Phenotype: Description	Reference	Availability	Comments
ΔrrmJ (Keio:JW3146)	deletion	deletion			PMID:16738554	Shigen CGSC10390^[5]
rlmED83A		D83A		5-fold decrease in activity. Increase in Km for 50S subunit and for S- adenosyl-L-methionine. Loss of S- adenosyl-L-methionine binding			seeded from UniProt:P0C0R7
rlmES197A		S197A		No change in activity. Increase in Km for 50S subunit			seeded from UniProt:P0C0R7
rlmEE199A		E199A		16-fold decrease in activity. No change in S-adenosyl-L-methionine binding			seeded from UniProt:P0C0R7
rlmED20A		D20A		2-fold decrease in activity. Increase in Km for 50S subunit			seeded from UniProt:P0C0R7
rlmEY22A		Y22A		No change in activity			seeded from UniProt:P0C0R7
rlmER32A		R32A		4-fold decrease in activity and increase in Km for 50S subunit; when associated with A-34			seeded from UniProt:P0C0R7
rlmER34A		R34A		4-fold decrease in activity and increase in Km for 50S subunit; when associated with A-32			seeded from UniProt:P0C0R7
rlmEK38A		K38A		Loss of activity. Almost no change in S-adenosyl-L-methionine binding			seeded from UniProt:P0C0R7
rlmED124A		D124A		Loss of activity. Loss of S- adenosyl-L-methionine binding			seeded from UniProt:P0C0R7
rlmED136N		D136N		2-fold decrease in activity			seeded from UniProt:P0C0R7
rlmEK164A		K164A		Loss of activity. No change in S- adenosyl-L-methionine binding			seeded from UniProt:P0C0R7
rlmEK189A		K189A		9-fold decrease in activity			seeded from UniProt:P0C0R7
rlmER194A		R194A		No change in activity. Increase in Km for 50S subunit			seeded from UniProt:P0C0R7
rlmEY201A		Y201A		5-fold decrease in activity. Almost no change in S-adenosyl-L-methionine binding			seeded from UniProt:P0C0R7
ΔrrmJ786::kan					PMID:16738554	CGSC:102804
rlmE	deletion		Sensitivity to	increases sensitivity to bicyclomycin	PMID:21357484		fig 2
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

</protect>

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW3146	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCACAGGTAAGAAGCGTTCTGC Primer 2:CCGGGTTTACGCCCGGTCGCTAC
18H7	Kohara Phage	Genobase	PMID:3038334
14F11	Kohara Phage	Genobase	PMID:3038334
aer-3075::Tn10	Linked marker	CAG12152 = CGSC7438^[5]	est. P1 cotransduction: % ^[6] Synonyms:zgh-3075::Tn10, zgj-3075::Tn10
sfsB203::Tn10	Linked marker	CAG12072 = CGSC7440^[5]	est. P1 cotransduction: 81% ^[6] Synonyms:zgj-203::Tn10, zha-203::Tn10
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b3179
ECOL199310CYC (EcoliWiki Page)	ECOL199310CYC:C3936
ECOO157CYC (EcoliWiki Page)	ECOO157CYC:FTSJ
CGSC (EcoliWiki Page)	CGSC:33511
EcoCyc (EcoliWiki Page)	ECOCYC:EG11507	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:947689	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	RlmE
Synonyms	23S rRNA methyltransferase^[1], B3179^[2]^[1], RrmJ^[2]^[1], MrsF^[2]^[1], FtsJ^[2]^[1] , ECK3168, ftsJ, JW3146, mrsF, rrmJ, b3179
Product description	23S rRNA m2U2552 methyltransferase^[2]^[3] 23S rRNA U2552 ribose 2'-O-methyltransferase, SAM-dependent; involved in cell division and growth; heat inducible; suppresssed by cloned ObgE and Der^[4]
EC number (for enzymes)	2.1.1.-^[1]
edit table

Notes

Function

[back to top]

<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0003676	nucleic acid binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR002877	F	Seeded from EcoCyc (v14.0)	complete
	GO:0005737	cytoplasm	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_01547	C	Seeded from EcoCyc (v14.0)	complete
	GO:0005737	cytoplasm	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0963	C	Seeded from EcoCyc (v14.0)	complete
	GO:0005737	cytoplasm	GO_REF:0000023	IEA: Inferred from Electronic Annotation	SP_SL:SL-0086	C	Seeded from EcoCyc (v14.0)	complete
	GO:0006950	response to stress	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0346	P	Seeded from EcoCyc (v14.0)	complete
	GO:0008650	rRNA (uridine-2'-O-)-methyltransferase activity	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_01547	F	Seeded from EcoCyc (v14.0)	complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	References	Evidence
Protein	aceF	PMID:15690043	Experiment(s):EBI-881132
Protein	clpA	PMID:15690043	Experiment(s):EBI-881132
Protein	ffh	PMID:15690043	Experiment(s):EBI-881132
Protein	lon	PMID:15690043	Experiment(s):EBI-881132
Protein	rplA	PMID:15690043	Experiment(s):EBI-881132
Protein	rplC	PMID:15690043	Experiment(s):EBI-881132
Protein	rplD	PMID:15690043	Experiment(s):EBI-881132
Protein	rplV	PMID:15690043	Experiment(s):EBI-881132
Protein	rpsB	PMID:15690043	Experiment(s):EBI-881132
Protein	rpsD	PMID:15690043	Experiment(s):EBI-881132
Protein	rpsE	PMID:15690043	Experiment(s):EBI-881132
Protein	rpsG	PMID:15690043	Experiment(s):EBI-881132
Protein	tufA	PMID:15690043	Experiment(s):EBI-881132
Protein	rplJ	PMID:15690043	Experiment(s):EBI-881132
Protein	groL	PMID:16606699	Experiment(s):EBI-1145040
Protein	yfdQ	PMID:16606699	Experiment(s):EBI-1145040
Protein	rplJ	PMID:16606699	Experiment(s):EBI-1145040
Protein	speD	PMID:16606699	Experiment(s):EBI-1145040
Protein	ygbA	PMID:16606699	Experiment(s):EBI-1145040
Protein	rplA	PMID:19402753	MALDI(Z-score):23.770470
Protein	tufB	PMID:19402753	MALDI(Z-score):23.014924
Protein	lon	PMID:19402753	MALDI(Z-score):28.131900
Protein	clpA	PMID:19402753	MALDI(Z-score):24.748640
Protein	ffh	PMID:19402753	MALDI(Z-score):34.290099
edit table

</protect>

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source	Notes
edit table

Notes

Structure and Physical Properties

[back to top]

<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MTGKKRSASS SRWLQEHFSD KYVQQAQKKG LRSRAWFKLD EIQQSDKLFK PGMTVVDLGA APGGWSQYVV TQIGGKGRII ACDLLPMDPI VGVDFLQGDF RDELVMKALL ERVGDSKVQV VMSDMAPNMS GTPAVDIPRA MYLVELALEM CRDVLAPGGS FVVKVFQGEG FDEYLREIRS LFTKVKVRKP DSSRARSREV YIVATGRKP
Length	209
Mol. Wt	23.334 kDa
pI	9.8 (calculated)
Extinction coefficient	23,950 - 24,200 (calc based on 5 Y, 3 W, and 2 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
Domain	31..207	PF01728 FtsJ-like methyltransferase		PMID:19920124
edit table

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=rrmJ taxon=562,83333 </beststructure>

Models

View models at:

edit table

</protect>

Structure figures

</protect>

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16131069	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:947689	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P0C0R7	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:947689	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Notes	Reference(s)
Protein	Ecoli K-12	10.389+/-0.147	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		Single Molecule Fluorescence	PMID:20671182
Protein	E. coli K-12 MG1655	1629	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	325	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	1851	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
rrmJ-hflB
edit table

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<protect><gbrowseImage> name=NC_000913:3325666..3325706 source=MG1655 flip=1 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b3179 (EcoliWiki Page)	NCBI GEO profiles for rrmJ
microarray	GenExpDB:b3179 (EcoliWiki Page)	Summary of data for rrmJ from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
	GFP Fusion	Intergenic region (3325205..3325479) fused to gfpmut2.	OpenBioSystems	GFP fusion described in Zaslaver, et al. Plate:109-AZ11; Well:E1^[7]
edit table

Notes

Accessions Related to rlmE Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b3179
RegulonDB	RegulonDB:	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Anopheles gambiae	ENSANGP00000014205 (score: 1.000; bootstrap: 53%) ENSANGP00000026202 (score: 0.067)	From Inparanoid:20070104
Apis mellifera	ENSAPMP00000017171 (score: 1.000; bootstrap: 98%)	From Inparanoid:20070104
Arabidopsis thaliana	AT4G25730 (score: 1.000; bootstrap: 76%)	From Inparanoid:20070104
Bos taurus	ENSBTAP00000003214 (score: 1.000; bootstrap: 65%)	From Inparanoid:20070104
Caenorhabditis briggsae	WBGene00040049 (score: 1.000; bootstrap: 55%)	From Inparanoid:20070104
Caenorhabditis elegans	WBGene00009735 (score: 1.000; bootstrap: 64%)	From Inparanoid:20070104
Canis familiaris	ENSCAFP00000024186 (score: 1.000; bootstrap: 68%)	From Inparanoid:20070104
Ciona intestinalis	ENSCINP00000009727 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Danio rerio	ZDB-GENE-041114-83 (score: 1.000; bootstrap: 100%) ZDB-CDNA-041114-83 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Dictyostelium discoideum	DDB0168604 (score: 1.000; bootstrap: 56%)	From Inparanoid:20070104
Drosophila melanogaster	FBgn0038737 (score: 1.000; bootstrap: 60%)	From Inparanoid:20070104
Drosophila pseudoobscura	GA11008-PA (score: 1.000; bootstrap: 61%)	From Inparanoid:20070104
Gallus gallus	ENSGALP00000006732 (score: 1.000; bootstrap: 64%)	From Inparanoid:20070104
Homo sapiens	ENSP00000327660 (score: 1.000; bootstrap: 69%)	From Inparanoid:20070104
Macaca mulatta	ENSMMUP00000022396 (score: 1.000; bootstrap: 69%)	From Inparanoid:20070104
Monodelphis domestica	ENSMODP00000012180 (score: 1.000; bootstrap: 54%)	From Inparanoid:20070104
Mus musculus	MGI:1915267 (score: 1.000; bootstrap: 66%)	From Inparanoid:20070104
Oryza gramene	Q688W3 (score: 1.000; bootstrap: 85%)	From Inparanoid:20070104
Pan troglodytes	ENSPTRP00000032192 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Rattus norvegicus	ENSRNOP00000001702 (score: 1.000; bootstrap: 67%)	From Inparanoid:20070104
Saccharomyces cerevisiae	YGL136C (score: 1.000; bootstrap: 66%)	From Inparanoid:20070104
Schizosaccharomyces pombe	SPAC4F103c (score: 1.000; bootstrap: 66%) SPAC16871 (score: 0.104)	From Inparanoid:20070104
Takifugu rubripes	NEWSINFRUP00000138138 (score: 1.000; bootstrap: 57%)	From Inparanoid:20070104
Tetraodon nigroviridis	GSTENP00010080001 (score: 1.000; bootstrap: 65%)	From Inparanoid:20070104
Xenopus tropicalis	ENSXETP00000012452 (score: 1.000; bootstrap: 89%)	From Inparanoid:20070104
Shigella flexneri	FTSJ	From SHIGELLACYC
E. coli O157	FTSJ	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Pfam (EcoliWiki Page)	PF01728 FtsJ-like methyltransferase
Superfamily (EcoliWiki Page)	SUPERFAMILY:53335
Panther (EcoliWiki Page)	PTHR10920:SF11
EcoCyc	EcoCyc:	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.00 ^1.01 ^1.02 ^1.03 ^1.04 ^1.05 ^1.06 ^1.07 ^1.08 ^1.09 ^1.10 ^1.11 ^1.12 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.00 ^2.01 ^2.02 ^2.03 ^2.04 ^2.05 ^2.06 ^2.07 ^2.08 ^2.09 ^2.10 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.0 ^3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ ^5.0 ^5.1 ^5.2 CGSC: The Coli Genetics Stock Center
↑ ^6.0 ^6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed

rlmE:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to rlmE Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search