recF:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
recF |
---|---|
Mnemonic |
Recombination |
Synonyms |
ECK3692, b3700, JW3677, uvrF[1], uvrF |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
83.59 minutes, 83.59 minutes |
MG1655: 3879244..3878171 |
||
NC_012967: 3841582..3840509 |
||||
NC_012759: 3766504..3767577 |
||||
W3110 |
|
W3110: 3759194..3760267 |
||
DH10B: 3976828..3975755 |
||||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
Coding Start (SO:0000323) |
3878174 |
Edman degradation |
| ||
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
recF(del) (Keio:JW3677) |
deletion |
deletion |
|||||
recF::Tn5KAN-I-SceI (FB21402) |
Insertion at nt 370 in Plus orientation |
does not contain pKD46 | |||||
recF::Tn5KAN-I-SceI (FB21403) |
Insertion at nt 370 in Plus orientation |
contains pKD46 | |||||
recFK36R |
K36R |
Weakly active |
seeded from UniProt:P0A7H0 | ||||
recF143 |
|||||||
recF400::Tn5 |
|||||||
recF |
deletion |
Sensitivity to |
decreases sensitivity to Bicyclomycin |
fig 2 | |||
recF349 |
Growth Phenotype |
Mutations show approximately 50% decrease in viability relative to the wild type, table 1. |
JC18536 |
||||
recF4101 priA2:kan |
Growth Phenotype |
Double mutation decreases cell viability from wildtype, table 1. |
experimental strain: JC18991 |
||||
recF4115 priA2:kan |
Growth Phenotype |
Double mutation decreases cell viability, table 1. |
JC18996 |
||||
recF143 priA2::kan |
Growth Phenotype |
Double mutation causes decreased cell viability, table 1. |
JC18989 |
||||
recF143 |
Sensitivity to |
mutant shows attenuated UV-inducible SOS expression compared to wildtype, fig 1B. |
| ||||
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW3677 |
Plasmid clone |
Status:Clone OK Primer 1:GCCTCCCTCACCCGCTTGTTGAT Primer 2:CCATCCGTTATTTTACCCTTTTC | |
Kohara Phage |
|||
zid-501::Tn10 |
Linked marker |
est. P1 cotransduction: 87% [11] | |
Linked marker |
est. P1 cotransduction: 9% [11] | ||
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Griffin, TJ 4th & Kolodner, RD (1990) Purification and preliminary characterization of the Escherichia coli K-12 recF protein. J. Bacteriol. 172 6291-9 PubMed
- ↑ Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 4.0 4.1 Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ Thoms, B & Wackernagel, W (1988) Suppression of the UV-sensitive phenotype of Escherichia coli recF mutants by recA(Srf) and recA(Tif) mutations requires recJ+. J. Bacteriol. 170 3675-81 PubMed
- ↑ Tran, L et al. (2011) Single-gene deletion mutants of Escherichia coli with altered sensitivity to bicyclomycin, an inhibitor of transcription termination factor Rho. J. Bacteriol. 193 2229-35 PubMed
- ↑ 7.0 7.1 7.2 7.3 7.4 Sandler, SJ (1996) Overlapping functions for recF and priA in cell viability and UV-inducible SOS expression are distinguished by dnaC809 in Escherichia coli K-12. Mol. Microbiol. 19 871-80 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 10.0 10.1 CGSC: The Coli Genetics Stock Center
- ↑ 11.0 11.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).