rbsK:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
rbsK |
|---|---|
| Mnemonic |
Ribose |
| Synonyms |
ECK3746, b3752, JW3731[1], JW3731 |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
84.82 minutes, 84.82 minutes |
MG1655: 3935317..3936246 |
||
|
NC_012967: 3899101..3900030 |
||||
|
NC_012759: 3823650..3824579 |
||||
|
W3110 |
|
W3110: 3699387..3698458 |
||
|
DH10B: 4032901..4033830 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
3935317 |
Edman degradation |
| ||
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
rbsK(del) (Keio:JW3731) |
deletion |
deletion |
|||||
|
rbsK3 |
|||||||
|
rbsK781(del)::kan |
|||||||
|
fucA(del) fucO(del) rbsK(del) |
deletion |
deletion |
in vivo |
Triple mutant caused elimination of colony in vivo (mice), FIgure 2. |
Parental: MG1655 |
||
|
rbsK781(del)::FRTKanFRT |
deletion |
Mutagenesis Rate |
Decrease in Stress Induced Mutagenesis (SIM). |
Parent Strain: SMR4562 Experimental Strain: SMR12584 |
The mutation conferred a strong decrease in the SIM with mutant frequency reduced by over 90 percent. See table S3 for full experimental data. | ||
|
SMR4562 yiaG-yfp FRTcatFRT rbsK781(del)::FRTKanFRT |
Deletion |
SigmaS activity |
See table S8 for full experimental data. |
Parental Strain: SMR10582 Experimental Strain: SMR13312 |
See table S8 for full experimental strain | ||
| edit table |
Notes
Genetic Interactions
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3731 |
Plasmid clone |
Status:Clone OK Primer 1:GCCCAAAACGCAGGCAGCCTCGT Primer 2:CCtCTCTGCCTGTCTAAAAATGC | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 83% [9] | ||
|
Linked marker |
est. P1 cotransduction: 53% [9] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Hope, JN et al. (1986) Ribokinase from Escherichia coli K12. Nucleotide sequence and overexpression of the rbsK gene and purification of ribokinase. J. Biol. Chem. 261 7663-8 PubMed
- ↑ 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
- ↑ Autieri, SM et al. (2007) L-fucose stimulates utilization of D-ribose by Escherichia coli MG1655 DeltafucAO and E. coli Nissle 1917 DeltafucAO mutants in the mouse intestine and in M9 minimal medium. Infect. Immun. 75 5465-75 PubMed
- ↑ 6.0 6.1 Al Mamun, AA et al. (2012) Identity and function of a large gene network underlying mutagenic repair of DNA breaks. Science 338 1344-8 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 8.0 8.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).