prmC:On One Page

From EcoliWiki
Jump to: navigation, search

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Quickview | Gene | Product(s) | Expression| Evolution | References |

Quickview

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

<protect>

Standard Name

prmC

Gene Synonym(s)

ECK1200, b1212, JW1203, hemK[1], hemK

Product Desc.

EG12424[2][3]

Release factor (RF1, RF2) glutamine methyltransferase[4]

Product Synonyms(s)

N5-glutamine methyltransferase, modifies release factors RF-1 and RF-2[1], B1212[2][1], PrmC[2][1], HemK[2][1] , ECK1200, hemK, JW1203, b1212

Function from GO

<GO_nr />

Knock-Out Phenotype
Regulation/Expression

transcription unit(s): hemA[2]

Regulation/Activity
Quick Links

porteco.png EcoCyc.gif regulondb.jpg

dnadisplay.png proteindisplay.png   pubmed.jpg   textpresso.jpg  

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]


prmC(hemK) was originally isolated as a suppressor of the light sensitivity of hemH, now likely to be an indirect effect.[4]



Gene

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

prmC

Mnemonic

Protein methylation

Synonyms

ECK1200, b1212, JW1203, hemK[1], hemK

</protect>

Notes

Location(s) and DNA Sequence

[back to top]


<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

27.27 minutes 

MG1655: 1265317..1266150
<gbrowseImage> name=NC_000913:1265317..1266150 source=MG1655 preset=GeneLocation </gbrowseImage>

REL606

NC_012967: 1266244..1267077
<gbrowseImage> name=NC_012967:1266244..1267077 source=REL606 preset=GeneLocation </gbrowseImage>

BW2952

NC_012759: 1154038..1154871
<gbrowseImage> name=NC_012759:1154038..1154871 source=BW2952 preset=GeneLocation </gbrowseImage>

W3110

 

W3110: 1267671..1268504
<gbrowseImage> name=NC_007779:1267671..1268504 source=W3110 preset=GeneLocation </gbrowseImage>

DH10B

DH10B: 1305558..1306391
<gbrowseImage> name=NC_010473:1305558..1306391 source=DH10B preset=GeneLocation </gbrowseImage>

</protect>

Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

<protect></protect>

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

<protect></protect>

Notes

Genetic Interactions

[back to top]


<protect>

Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

</protect>

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW1203

Plasmid clone

Shigen

PMID:16769691

Status:Clone OK

Primer 1:GCCGAATATCAACACTGGTTACG

Primer 2:CCTTGATAATAGCGGCCGAGCGT

4D10

Kohara Phage

Genobase

PMID:3038334

13H6

Kohara Phage

Genobase

PMID:3038334

fadR13::Tn10

Linked marker

CAG18497 = CGSC7365[5]

est. P1 cotransduction: 29% [6]

oppC506::Tn10

Linked marker

CAG12169 = CGSC7369[5]

est. P1 cotransduction: 20% [6]
Synonyms:zch-506::Tn10, zci-506::Tn10

<protect></protect>

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG12424

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG12424

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120002282

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:945779

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB2323

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0004068

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



Product(s)

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name

PrmC

Synonyms

N5-glutamine methyltransferase, modifies release factors RF-1 and RF-2[1], B1212[2][1], PrmC[2][1], HemK[2][1] , ECK1200, hemK, JW1203, b1212

Product description

EG12424[2][3]

Release factor (RF1, RF2) glutamine methyltransferase[4]

EC number (for enzymes)

<protect></protect>

Notes

Function

[back to top]


<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier GO ID GO term name Reference Evidence Code with/from Aspect Notes Status

GO:0005737

cytoplasm

C

Seeded from Riley et al 2006 [1].

Missing: evidence, reference

GO:0003676

nucleic acid binding

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR002052

F

Seeded from EcoCyc (v14.0)

complete

GO:0006479

protein amino acid methylation

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR004556

P

Seeded from EcoCyc (v14.0)

complete

GO:0008168

methyltransferase activity

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR002052

F

Seeded from EcoCyc (v14.0)

complete

GO:0008168

methyltransferase activity

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR007848

F

Seeded from EcoCyc (v14.0)

complete

GO:0008168

methyltransferase activity

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0489

F

Seeded from EcoCyc (v14.0)

complete

GO:0008276

protein methyltransferase activity

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR004556

F

Seeded from EcoCyc (v14.0)

complete

GO:0016740

transferase activity

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0808

F

Seeded from EcoCyc (v14.0)

complete

GO:0032259

methylation

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR002052

P

Seeded from EcoCyc (v14.0)

complete

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type Partner Notes References Evidence

Protein

atpG

PMID:16606699

Experiment(s):EBI-1139194

</protect>

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment Description Evidence Reference/Source Notes

<protect></protect>

Notes

Structure and Physical Properties

[back to top]


<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence

at EcoCyc

MEYQHWLREA ISQLQASESP RRDAEILLEH VTGRGRTFIL AFGETQLTDE QCQQLDALLT
RRRDGEPIAH LTGVREFWSL PLFVSPATLI PRPDTECLVE QALARLPEQP CRILDLGTGT
GAIALALASE RPDCEIIAVD RMPDAVSLAQ RNAQHLAIKN IHILQSDWFS ALAGQQFAMI
VSNPPYIDEQ DPHLQQGDVR FEPLTALVAA DSGMADIVHI IEQSRNALVS GGFLLLEHGW
QQGEAVRQAF ILAGYHDVET CRDYGDNERV TLGRYYQ
Length

277

Mol. Wt

30.974 kDa

pI

4.7 (calculated)

Extinction coefficient

30,940 - 31,565 (calc based on 6 Y, 4 W, and 5 C residues)


Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type Residues Description Notes References

Domain

94..253

PF05175 Methyltransferase small domain

PMID:19920124

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=prmC taxon=562,83333 </beststructure>

Models

View models at:

</protect>

Structure figures

<protect>

</protect>

Notes

Gene Product Resources

[back to top]


See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type Source Notes/Reference

<protect></protect>

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

NCBI (Protein) (EcoliWiki Page)

GI:16129175

Escherichia coli str. K-12 substr. MG1655

NCBI (Protein) (EcoliWiki Page)

GeneID:945779

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0004068

Escherichia coli str. K-12 substr. MG1655

UniProt (EcoliWiki Page)

UniProtKB/Swiss-Prot:P0ACC1

Escherichia coli str. K-12 substr. MG1655

EcoCyc

EcoCyc:EG12424

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG12424

Escherichia coli str. K-12 substr. MG1655

NCBI (Gene) (EcoliWiki Page)

GeneID:945779

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120002282

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB2323

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]




Expression

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.


Cellular Levels

[back to top]


See Help:Cellular levels

Molecule Organism or Strain Value Units Experimental Conditions Assay used Notes Reference(s)

Protein

E. coli K-12 MG1655

188

molecules/cell/generation

  • Medium: MOPS Complete
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

36

molecules/cell/generation

  • Medium: MOPS Minimal
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

108

molecules/cell/generation

  • Medium: MOPS Complete without Methionine
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Notes

Transcription and Transcriptional Regulation

[back to top]


<protect>

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)

hemA

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]


<protect><gbrowseImage> name=NC_000913:1265297..1265337 source=MG1655 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]


<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name Mutation Phenotype Reference


Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type Reference Notes

microarray

GEO Profiles:b1212 (EcoliWiki Page)

NCBI GEO profiles for prmC

microarray

GenExpDB:b1212 (EcoliWiki Page)

Summary of data for prmC from multiple microarray studies


Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name Resource Type Description Source Notes

<protect></protect>

Notes

Accessions Related to prmC Expression

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG12424

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB2323

Escherichia coli str. K-12 substr. MG1655

EcoliGenExpDB (EcoliWiki Page)

EcoliGenExpDB:b1212

EcoGene

EcoGene:EG12424

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120002282

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0004068

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



Evolution

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]


See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism Homologs (Statistics) Comments

Anopheles gambiae

  • ENSANGP00000012301 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Apis mellifera

  • ENSAPMP00000002790 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Arabidopsis thaliana

  • AT5G64150 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Bos taurus

  • ENSBTAP00000005382 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Canis familiaris

  • ENSCAFP00000015126 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Dictyostelium discoideum

  • DDB0205497 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Drosophila melanogaster

  • FBgn0031817 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Drosophila pseudoobscura

  • GA21859-PA (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Gallus gallus

  • ENSGALP00000003530 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Homo sapiens

  • ENSP00000232854 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Macaca mulatta

  • ENSMMUP00000013762 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Monodelphis domestica

  • ENSMODP00000015017 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Mus musculus

  • MGI:1916786 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Pan troglodytes

  • ENSPTRP00000025838 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Rattus norvegicus

  • ENSRNOP00000020781 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Saccharomyces cerevisiae

  • YNL063W (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Schizosaccharomyces pombe

  • SPAC29B125c (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Tetraodon nigroviridis

  • GSTENP00027529001 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Xenopus tropicalis

  • ENSXETP00000013951 (score: 1.000; bootstrap: 99%)

From Inparanoid:20070104

Shigella flexneri

HEMK

From SHIGELLACYC

E. coli O157

HEMK

From ECOO157CYC

<protect></protect>

Notes

Families

[back to top]


<protect> See Help:Evolution_families for help entering or editing information in this section of EcoliWiki.

Database Accession Notes

Pfam (EcoliWiki Page)

PF05175 Methyltransferase small domain


</protect> <protect></protect>

Notes

Links

[back to top]



References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  3. 3.0 3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  4. 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
  5. 5.0 5.1 CGSC: The Coli Genetics Stock Center
  6. 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories

[back to top]