pfkA:On One Page

From EcoliWiki
Jump to: navigation, search

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Quickview | Gene | Product(s) | Expression| Evolution | References |

Quickview

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

<protect>

Standard Name

pfkA

Gene Synonym(s)

ECK3908, b3916, JW3887[1], JW3887

Product Desc.

6-phosphofructokinase-1[2][3]

6-phosphofructokinase-1; allosteric: activated by MgNDPs, inhibited by PEP; homoterameric[4]

Product Synonyms(s)

6-phosphofructokinase I[1], B3916[2][1], PfkA[2][1] , ECK3908, JW3887, b3916

Function from GO

<GO_nr />

Knock-Out Phenotype
Regulation/Expression

transcription unit(s): pfkA[2]

Regulation/Activity
Quick Links

porteco.png EcoCyc.gif regulondb.jpg

dnadisplay.png proteindisplay.png   pubmed.jpg   textpresso.jpg  

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]





Gene

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

pfkA

Mnemonic

Phosphofructokinase

Synonyms

ECK3908, b3916, JW3887[1], JW3887

</protect>

Notes

Location(s) and DNA Sequence

[back to top]


<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

88.49 minutes 

MG1655: 4105575..4106537
<gbrowseImage> name=NC_000913:4105575..4106537 source=MG1655 preset=GeneLocation </gbrowseImage>

REL606

NC_012967: 4087034..4087996
<gbrowseImage> name=NC_012967:4087034..4087996 source=REL606 preset=GeneLocation </gbrowseImage>

BW2952

NC_012759: 3995244..3996206
<gbrowseImage> name=NC_012759:3995244..3996206 source=BW2952 preset=GeneLocation </gbrowseImage>

W3110

 

W3110: 3529129..3528167
<gbrowseImage> name=NC_007779:3528167..3529129 source=W3110 preset=GeneLocation </gbrowseImage>

DH10B

DH10B: 4205272..4206234
<gbrowseImage> name=NC_010473:4205272..4206234 source=DH10B preset=GeneLocation </gbrowseImage>

</protect>

Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

<protect></protect>

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔpfkA (Keio:JW3887)

deletion

deletion

PMID:16738554

Shigen
CGSC10802[5]

pfkAD128S

D128S

18000-fold reduction of catalytic rate

seeded from UniProt:P0A796

pfkAR172S

R172S

3.4-fold reduction in turnover numbers

seeded from UniProt:P0A796

ΔpfkA::kan

deletion

Biolog:respiration

unable to respire b-Methyl-D-glucoside

PMID:16095938

ΔpfkA::kan

deletion

Biolog:respiration

unable to respire D-Sorbitol

PMID:16095938

pfkA1

CGSC:8061

pfkA300::Mu

CGSC:11947

pfkA203(del-ins)::FRT

PMID:16289704

CGSC:90945

ΔpfkA775::kan

PMID:16738554

CGSC:102296

pfkA

Resistant to

Resistant to streptozotocin

PMID:6450313


<protect></protect>

Notes

Genetic Interactions

[back to top]


<protect>

Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

</protect>

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW3887

Plasmid clone

Shigen

PMID:16769691

Status:Clone OK

Primer 1:GCCATTAAGAAAATCGGTGTGTT

Primer 2:CCATACAGTTTTTTCGCGCAGTC

8B10

Kohara Phage

Genobase

PMID:3038334

zih-35::Tn10

Linked marker

CAG18495 = CGSC7467[5]

est. P1 cotransduction: 17% [6]

pflD501::Tn10

Linked marker

CAG18477 = CGSC7470[5]

est. P1 cotransduction: 21% [6]
Synonyms:zij-501::Tn10 nnnCAG18477 also carries metF79(Am) (CGSC).

<protect></protect>

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10699

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10699

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000691

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:948412

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0693

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0012789

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



Product(s)

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name

PfkA

Synonyms

6-phosphofructokinase I[1], B3916[2][1], PfkA[2][1] , ECK3908, JW3887, b3916

Product description

6-phosphofructokinase-1[2][3]

6-phosphofructokinase-1; allosteric: activated by MgNDPs, inhibited by PEP; homoterameric[4]

EC number (for enzymes)

<protect></protect>

Notes

Function

[back to top]


<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier GO ID GO term name Reference Evidence Code with/from Aspect Notes Status

GO:0000287

magnesium ion binding

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0460

F

Seeded from EcoCyc (v14.0)

complete

GO:0003872

6-phosphofructokinase activity

GOA:hamap
GO_REF:0000020

IEA: Inferred from Electronic Annotation

HAMAP:MF_00339

F

Seeded from EcoCyc (v14.0)

complete

GO:0003872

6-phosphofructokinase activity

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR000023

F

Seeded from EcoCyc (v14.0)

complete

GO:0003872

6-phosphofructokinase activity

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR012828

F

Seeded from EcoCyc (v14.0)

complete

GO:0003872

6-phosphofructokinase activity

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR015912

F

Seeded from EcoCyc (v14.0)

complete

GO:0003872

6-phosphofructokinase activity

GOA:spec
GO_REF:0000003

IEA: Inferred from Electronic Annotation

EC:2.7.1.11

F

Seeded from EcoCyc (v14.0)

complete

GO:0005524

ATP binding

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR012003

F

Seeded from EcoCyc (v14.0)

complete

GO:0005524

ATP binding

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR012828

F

Seeded from EcoCyc (v14.0)

complete

GO:0005524

ATP binding

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0067

F

Seeded from EcoCyc (v14.0)

complete

GO:0005945

6-phosphofructokinase complex

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR000023

C

Seeded from EcoCyc (v14.0)

complete

GO:0005945

6-phosphofructokinase complex

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR015912

C

Seeded from EcoCyc (v14.0)

complete

GO:0006002

fructose 6-phosphate metabolic process

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR012003

P

Seeded from EcoCyc (v14.0)

complete

GO:0006002

fructose 6-phosphate metabolic process

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR012828

P

Seeded from EcoCyc (v14.0)

complete

GO:0006096

glycolysis

GOA:hamap
GO_REF:0000020

IEA: Inferred from Electronic Annotation

HAMAP:MF_00339

P

Seeded from EcoCyc (v14.0)

complete

GO:0006096

glycolysis

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR000023

P

Seeded from EcoCyc (v14.0)

complete

GO:0006096

glycolysis

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR012003

P

Seeded from EcoCyc (v14.0)

complete

GO:0006096

glycolysis

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR012828

P

Seeded from EcoCyc (v14.0)

complete

GO:0006096

glycolysis

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR015912

P

Seeded from EcoCyc (v14.0)

complete

GO:0006096

glycolysis

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0324

P

Seeded from EcoCyc (v14.0)

complete

GO:0003872

6-phosphofructokinase activity

PMID:125265

IMP: Inferred from Mutant Phenotype

F

complete

GO:0005524

ATP binding

PMID:8202475

IMP: Inferred from Mutant Phenotype

F

Mutation of threonine at position 125 to serine in PfkA prevents allosteric activation and PEP-dependent inhibition.

complete

GO:0005945

6-phosphofructokinase complex

PMID:6232272

IDA: Inferred from Direct Assay

C

Renaturation of purified PfkA after treatment with 7M guanidine hydrochloride resulted in recovery of catalytic activity and allosteric regulation.

complete

GO:0000287

magnesium ion binding

PMID:1445885

IDA: Inferred from Direct Assay

F

complete

GO:0032553

ribonucleotide binding

PMID:4229913

IDA: Inferred from Direct Assay

F

Purified phosphofructokinase was assayed in a coupled assay (as described in this paper) for activity in the presence of nucleotide-monophosphates, nucleotide-diphosphates and nucleotide-triphosphates. Activity was increased in the presence of nucleotide-diphosphates, in particular, GDP and ADP.

complete

GO:0005737

cytoplasm

PMID:4229913

IDA: Inferred from Direct Assay

C

complete

GO:0042802

identical protein binding

PMID:11946283

IDA: Inferred from Direct Assay

F

Phosphofructokinase was characterized to be a tetramer by sedimentation velocity and equilibrium experiments as well as SDS-PAGE analysis.

complete

GO:0044275

cellular carbohydrate catabolic process

PMID:4299078

IMP: Inferred from Mutant Phenotype

P

pfkA mutants are defective in utilization of glucose and mannitol.

complete

GO:0005488

binding

PMID:17307338

IDA: Inferred from Direct Assay

F

Phosphoenolpyruvate (CHEBI:18021) binding inhibits PfkA activity.

complete

GO:0006096

glycolysis

PMID:15237399

IDA: Inferred from Direct Assay

P

Pathway reconstituted in vitro with purified E. coli enzymes.

complete

GO:0006007

glucose catabolic process

PMID:4299078

IMP: Inferred from Mutant Phenotype

P

pfkA mutants are defective in growth on glucose.

complete

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type Partner Notes References Evidence

Protein

fpr

PMID:16606699

Experiment(s):EBI-1147000

Protein

tpiA

PMID:16606699

Experiment(s):EBI-1147000, EBI-1147023

Protein

argG

PMID:16606699

Experiment(s):EBI-1147000

Protein

aspS

PMID:16606699

Experiment(s):EBI-1147000

Small Molecule

phosphoenolpyruvate

Inhibitory


</protect>

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment Description Evidence Reference/Source Notes

<protect></protect>

Notes

Structure and Physical Properties

[back to top]


<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence

at EcoCyc

MIKKIGVLTS GGDAPGMNAA IRGVVRSALT EGLEVMGIYD GYLGLYEDRM VQLDRYSVSD
MINRGGTFLG SARFPEFRDE NIRAVAIENL KKRGIDALVV IGGDGSYMGA MRLTEMGFPC
IGLPGTIDND IKGTDYTIGF FTALSTVVEA IDRLRDTSSS HQRISVVEVM GRYCGDLTLA
AAIAGGCEFV VVPEVEFSRE DLVNEIKAGI AKGKKHAIVA ITEHMCDVDE LAHFIEKETG
RETRATVLGH IQRGGSPVPY DRILASRMGA YAIDLLLAGY GGRCVGIQNE QLVHHDIIDA
IENMKRPFKG DWLDCAKKLY
Length

320

Mol. Wt

34.842 kDa

pI

5.5 (calculated)

Extinction coefficient

21,890 - 22,640 (calc based on 11 Y, 1 W, and 6 C residues)


Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type Residues Description Notes References

Domain

3..278

PF00365 Phosphofructokinase

PMID:19920124

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=pfkA taxon=562,83333 </beststructure>

Models

View models at:

</protect>

Structure figures

<protect>

</protect>

Notes

Gene Product Resources

[back to top]


See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type Source Notes/Reference

<protect></protect>

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

NCBI (Protein) (EcoliWiki Page)

GI:16131754

Escherichia coli str. K-12 substr. MG1655

NCBI (Protein) (EcoliWiki Page)

GeneID:948412

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0012789

Escherichia coli str. K-12 substr. MG1655

UniProt (EcoliWiki Page)

UniProtKB/Swiss-Prot:P0A796

Escherichia coli str. K-12 substr. MG1655

EcoCyc

EcoCyc:EG10699

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10699

Escherichia coli str. K-12 substr. MG1655

NCBI (Gene) (EcoliWiki Page)

GeneID:948412

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000691

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0693

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]




Expression

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.


Cellular Levels

[back to top]


See Help:Cellular levels

Molecule Organism or Strain Value Units Experimental Conditions Assay used Notes Reference(s)

Protein

Ecoli K-12

125.932+/-1.049

Molecules/cell

  • Medium:
  • Temperature (°C):
  • Doubling time (min): Growth Rate(min): *
  • Growth phase: other: *

Single Molecule Fluorescence

PMID:20671182

mRNA

Ecoli K-12

0.233367983

Molecules/cell

  • Medium:
  • Temperature (°C):
  • Doubling time (min): Growth Rate(min): *
  • Growth phase: other: *

by RNA_Seq

PMID:20671182

Protein

E. coli K-12 MG1655

4667

molecules/cell/generation

  • Medium: MOPS Complete
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

2811

molecules/cell/generation

  • Medium: MOPS Minimal
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

3138

molecules/cell/generation

  • Medium: MOPS Complete without Methionine
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Notes

Transcription and Transcriptional Regulation

[back to top]


<protect>

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)

pfkA

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]


<protect><gbrowseImage> name=NC_000913:4105555..4105595 source=MG1655 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]


<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name Mutation Phenotype Reference


Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type Reference Notes

microarray

GEO Profiles:b3916 (EcoliWiki Page)

NCBI GEO profiles for pfkA

microarray

GenExpDB:b3916 (EcoliWiki Page)

Summary of data for pfkA from multiple microarray studies


Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name Resource Type Description Source Notes

GFP Fusion

Intergenic region (4104872..4105200) fused to gfpmut2.

OpenBioSystems

GFP fusion described in Zaslaver, et al.
Plate:109-AZ01; Well:G2[7]

<protect></protect>

Notes

Accessions Related to pfkA Expression

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10699

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0693

Escherichia coli str. K-12 substr. MG1655

EcoliGenExpDB (EcoliWiki Page)

EcoliGenExpDB:b3916

EcoGene

EcoGene:EG10699

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000691

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0012789

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



Evolution

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]


See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism Homologs (Statistics) Comments

Anopheles gambiae

  • ENSANGP00000025715 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Apis mellifera

  • ENSAPMP00000012688 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Arabidopsis thaliana

  • AT4G26270 (score: 1.000; bootstrap: 84%)
  • AT5G56630 (score: 0.868)
  • AT4G29220 (score: 0.747)
  • AT4G32840 (score: 0.707)
  • AT5G61580 (score: 0.655)
  • AT5G47810 (score: 0.416)
  • AT2G22480 (score: 0.340)

From Inparanoid:20070104

Bos taurus

  • ENSBTAP00000003472 (score: 1.000; bootstrap: 100%)
  • ENSBTAP00000000358 (score: 0.670)
  • ENSBTAP00000014086 (score: 0.624)

From Inparanoid:20070104

Caenorhabditis briggsae

  • WBGene00025167 (score: 1.000; bootstrap: 100%)
  • WBGene00038394 (score: 0.251)

From Inparanoid:20070104

Caenorhabditis elegans

  • WBGene00022199 (score: 1.000; bootstrap: 100%)
  • WBGene00008230 (score: 0.254)

From Inparanoid:20070104

Canis familiaris

  • ENSCAFP00000013277 (score: 1.000; bootstrap: 100%)
  • ENSCAFP00000016138 (score: 0.643)
  • ENSCAFP00000008221 (score: 0.625)

From Inparanoid:20070104

Ciona intestinalis

  • ENSCINP00000009557 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Danio rerio

  • ZDB-GENE-040912-135 (score: 1.000; bootstrap: 100%)
  • ZDB-CDNA-040912-137 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Dictyostelium discoideum

  • DDB0191364 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Drosophila melanogaster

  • FBgn0003071 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Drosophila pseudoobscura

  • GA17840-PA (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Gallus gallus

  • ENSGALP00000011230 (score: 1.000; bootstrap: 100%)
  • ENSGALP00000010557 (score: 0.543)
  • ENSGALP00000021650 (score: 0.207)

From Inparanoid:20070104

Homo sapiens

  • ENSP00000263145 (score: 1.000; bootstrap: 100%)
  • ENSP00000352842 (score: 0.679)
  • ENSP00000309438 (score: 0.633)

From Inparanoid:20070104

Macaca mulatta

  • ENSMMUP00000002741 (score: 1.000; bootstrap: 100%)
  • ENSMMUP00000006549 (score: 0.609)
  • ENSMMUP00000005583 (score: 0.460)

From Inparanoid:20070104

Monodelphis domestica

  • ENSMODP00000008095 (score: 1.000; bootstrap: 100%)
  • ENSMODP00000003803 (score: 0.411)

From Inparanoid:20070104

Mus musculus

  • MGI:97548 (score: 1.000; bootstrap: 100%)
  • MGI:97547 (score: 0.677)
  • MGI:1891833 (score: 0.664)

From Inparanoid:20070104

Oryza gramene

  • Q5JNC6 (score: 1.000; bootstrap: 86%)
  • Q65X97 (score: 1.000; bootstrap: 85%)
  • Q5SNH5 (score: 0.603)
  • Q6L4N6 (score: 0.582)
  • Q5VMJ5 (score: 0.571)
  • Q69QS5 (score: 0.350)
  • Q7FB09 (score: 0.281)
  • Q6EQ16 (score: 0.274)
  • Q6Z522 (score: 0.265)
  • Q948J0 (score: 0.225)
  • Q7XEV3 (score: 0.225)
  • Q7X9K2 (score: 0.078)

From Inparanoid:20070104

Pan troglodytes

  • ENSPTRP00000042531 (score: 1.000; bootstrap: 100%)
  • ENSPTRP00000003790 (score: 0.671)
  • ENSPTRP00000039186 (score: 0.407)

From Inparanoid:20070104

Rattus norvegicus

  • ENSRNOP00000013374 (score: 1.000; bootstrap: 100%)
  • ENSRNOP00000001625 (score: 0.679)
  • ENSRNOP00000023252 (score: 0.651)

From Inparanoid:20070104

Saccharomyces cerevisiae

  • YGR240C (score: 1.000; bootstrap: 100%)
  • YMR205C (score: 0.376)

From Inparanoid:20070104

Schizosaccharomyces pombe

  • SPBC16H52 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Takifugu rubripes

  • NEWSINFRUP00000173592 (score: 1.000; bootstrap: 100%)
  • NEWSINFRUP00000162597 (score: 0.838)
  • NEWSINFRUP00000181382 (score: 0.581)
  • NEWSINFRUP00000145340 (score: 0.543)
  • NEWSINFRUP00000178137 (score: 0.292)
  • NEWSINFRUP00000130965 (score: 0.064)

From Inparanoid:20070104

Tetraodon nigroviridis

  • GSTENP00015248001 (score: 1.000; bootstrap: 83%)
  • GSTENP00016608001 (score: 0.573)
  • GSTENP00028145001 (score: 0.417)
  • GSTENP00030519001 (score: 0.290)

From Inparanoid:20070104

Xenopus tropicalis

  • ENSXETP00000015829 (score: 1.000; bootstrap: 100%)
  • ENSXETP00000047469 (score: 0.626)

From Inparanoid:20070104

Shigella flexneri

PFKA

From SHIGELLACYC

E. coli O157

PFKA

From ECOO157CYC


Do-It-Yourself Web Tools

<protect></protect>

Notes

Families

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

Superfamily (EcoliWiki Page)

SUPERFAMILY:53784

Panther (EcoliWiki Page)

PTHR13697:SF0

Pfam (EcoliWiki Page)

PF00365 Phosphofructokinase

EcoCyc

EcoCyc:EG10699

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10699

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000691

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0693

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0012789

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. 2.0 2.1 2.2 2.3 2.4 2.5 2.6 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  3. 3.0 3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  4. 4.0 4.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
  5. 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
  6. 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
  7. Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed

Categories

[back to top]