pdxH:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
pdxH |
|---|---|
| Mnemonic |
Pyridoxine |
| Synonyms |
ECK1634, b1638, JW1630[1], JW1630 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
36.97 minutes |
MG1655: 1716031..1715375 |
||
|
NC_012967: 1695201..1694545 |
||||
|
NC_012759: 1607434..1608090 |
||||
|
W3110 |
|
W3110: 1719721..1719065 |
||
|
DH10B: 1806602..1805946 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
1715378 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔpdxH (Keio:JW1630) |
deletion |
deletion |
|||||
|
pdxH::Tn5KAN-2 (FB20401) |
Insertion at nt 417 in Plus orientation |
does not contain pKD46 | |||||
|
pdxH::Tn5KAN-2 (FB20402) |
Insertion at nt 417 in Plus orientation |
contains pKD46 | |||||
|
pdxHR14M |
R14M |
Reduces affinity for substrate about 9-fold, but has no effect on catalytic activity |
seeded from UniProt:P0AFI7 | ||||
|
pdxHY17F |
Y17F |
Reduces affinity for substrate 3- fold, but has about 5-fold increase in catalytic activity |
seeded from UniProt:P0AFI7 | ||||
|
pdxHD49A |
D49A |
Reduces affinity for substrate 3- fold and catalytic activity 2-fold |
seeded from UniProt:P0AFI7 | ||||
|
pdxHR14E |
R14E |
Reduces affinity for substrate about 7-fold, but has no effect on catalytic activity |
seeded from UniProt:P0AFI7 | ||||
|
pdxHR197E |
R197E |
Reduces affinity for substrate 8000-fold and catalytic activity 16-fold |
seeded from UniProt:P0AFI7 | ||||
|
pdxHR197M |
R197M |
Reduces affinity for substrate 300- fold and catalytic activity about 4-fold |
seeded from UniProt:P0AFI7 | ||||
|
pdxHH199A |
H199A |
Reduces affinity for substrate 230- fold, but has no effect on catalytic activity |
seeded from UniProt:P0AFI7 | ||||
|
pdxHH199N |
H199N |
Reduces catalytic activity about 4- fold, but has no effect on affinity for substrate |
seeded from UniProt:P0AFI7 | ||||
|
pdxH15(Am) |
amber (UAG) mutation | ||||||
|
ΔpdxH787::kan |
|||||||
|
ΔpdxH::ΩCmR |
Middle third of of the pdxH coding region was deleted and replaced by an ΩCmR cassette.[6] |
Auxotrophies |
Deletion inactivates the PYRIDOXINE 5'-PHOSPHATE OXIDASE or PMP PYRIDOXAMINE 5'-PHOSPHATE OXIDASE activities and prevents synthesis of pyridoxal phosphate. See Materials and Methods. |
Strain: TX2768 |
|||
|
pdxH::MudI-8 |
Exact insertion within pdxH is unknown, Figure 2. |
Exact insertion within pdxH is unknown, Figure 2. |
Auxotrophies |
pdxH::MudI-8 mutants show a requirement for pyridoxal that cannot be satisfied by Pyridoxine (Fig.1). Colonies of pdxH::MudI-8 grew slower than pdxH+ parent (table 2). Growth was also abnormal (fig. 7B) not due to MudI-8 insertion. Results were the same in aerobic and anaerobic conditions (Table 2). |
strain: NU1708, NU1709 |
| |
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW1630 |
Plasmid clone |
Status:Clone OK Primer 1:GCCTCTGATAACGACGAATTGCA Primer 2:CCGGGTGCAAGACGATCAATCTT | |
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: % [10] | ||
|
zdi-925::Tn10 |
Linked marker |
est. P1 cotransduction: 4% [10] | |
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 Zhao, G & Winkler, ME (1995) Kinetic limitation and cellular amount of pyridoxine (pyridoxamine) 5'-phosphate oxidase of Escherichia coli K-12. J. Bacteriol. 177 883-91 PubMed
- ↑ 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
- ↑ 5.0 5.1 Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ Man, TK et al. (1996) Isolation of a pdxJ point mutation that bypasses the requirement for the PdxH oxidase in pyridoxal 5' -phosphate coenzyme biosynthesis in Escherichia coli K-12. J. Bacteriol. 178 2445-9 PubMed
- ↑ Lam, HM & Winkler, ME (1992) Characterization of the complex pdxH-tyrS operon of Escherichia coli K-12 and pleiotropic phenotypes caused by pdxH insertion mutations. J. Bacteriol. 174 6033-45 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 10.0 10.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
