ompC:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
ompC |
|---|---|
| Mnemonic |
Outer membrane protein |
| Synonyms |
ECK2207, b2215, JW2203, meoA, par[1], par |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
49.78 minutes, 49.78 minutes |
MG1655: 2310771..2309668 |
||
|
NC_012967: 2262685..2261750 |
||||
|
NC_012759: 2195473..2196576 |
||||
|
W3110 |
|
W3110: 2316083..2314980 |
||
|
DH10B: 2401759..2400656 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
2309671 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ompC(del) (Keio:JW2203) |
deletion |
deletion |
|||||
|
ompC::Tn5KAN-2 (FB20710) |
Insertion at nt 469 in Plus orientation |
contains pKD46 | |||||
|
ompC::Tn5KAN-2 (FB20711) |
Insertion at nt 469 in Plus orientation |
does not contain pKD46 | |||||
|
ompC171 |
|||||||
|
ompC161 |
|||||||
|
ompC263 |
|||||||
|
ompC264 |
|||||||
|
ompC262 |
|||||||
|
ompC172 |
|||||||
|
ompC768(del)::kan |
|||||||
|
ompCp1 |
protein expression |
OmpC protein synthesis is constitutive, less repression in ompCp1 than in wild-type |
|||||
|
ompC- |
insertion |
Sensitivity to |
Decreased Sensitivity to Micromycin B17 |
See table 4 for full results. | |||
|
ompC in strain CE104 |
Resistant to |
Resistant to Me1 phage. |
Experimental Strain: CE104 Parental Strain: PC0479 |
| |||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2203 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAAAGTTAAAGTACTGTCCCT Primer 2:CCGAACTGGTAAACCAGACCCAG | |
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 75% [13] | ||
|
Linked marker |
est. P1 cotransduction: 71% [13] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Mizuno, T et al. (1983) DNA sequence of the promoter region of the ompC gene and the amino acid sequence of the signal peptide of pro-OmpC protein of Escherichia coli. FEBS Lett. 151 159-64 PubMed
- ↑ Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed
- ↑ Molloy, MP et al. (1998) Extraction of membrane proteins by differential solubilization for separation using two-dimensional gel electrophoresis. Electrophoresis 19 837-44 PubMed
- ↑ 5.0 5.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 6.0 6.1 6.2 CGSC: The Coli Genetics Stock Center
- ↑ 7.0 7.1 Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ Sato, T & Yura, T (1981) Regulatory mutations conferring constitutive synthesis of major outer membrane proteins (OmpC and OmpF) in Escherichia coli. J. Bacteriol. 145 88-96 PubMed
- ↑ Laviña, M et al. (1986) Identification, mapping, cloning and characterization of a gene (sbmA) required for microcin B17 action on Escherichia coli K12. J. Gen. Microbiol. 132 1685-93 PubMed
- ↑ Verhoef, C et al. (1979) Genetics and biochemistry of the peptidoglycan-associated proteins b and c of Escherichia coli K12. Mol. Gen. Genet. 169 137-46 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 13.0 13.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).