metK:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
metK |
|---|---|
| Mnemonic |
Methionine |
| Synonyms |
ECK2937, b2942, JW2909, metX[1], metX |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
66.49 minutes |
MG1655: 3084728..3085882 |
||
|
NC_012967: 2972457..2973611 |
||||
|
NC_012759: 2971876..2973030 |
||||
|
W3110 |
|
W3110: 3085362..3086516 |
||
|
DH10B: 3179797..3180951 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
3084731 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
metKD239N |
D239N |
Decrease in AdoMet synthesis |
seeded from UniProt:P0A817 | ||||
|
metKK246M |
K246M |
Loss of activity. modification in protein conformation |
seeded from UniProt:P0A817 | ||||
|
metKK266A |
K266A |
Loss of activity |
seeded from UniProt:P0A817 | ||||
|
metKK266M |
K266M |
Unstable; trace activity |
seeded from UniProt:P0A817 | ||||
|
metKK270M |
K270M |
Decrease in activity |
seeded from UniProt:P0A817 | ||||
|
metKD272N,A |
D272N,A |
Loss of activity |
seeded from UniProt:P0A817 | ||||
|
metKC240A |
C240A |
Decrease in AdoMet synthesis |
seeded from UniProt:P0A817 | ||||
|
metKR245H,L |
R245H,L |
Loss of activity |
seeded from UniProt:P0A817 | ||||
|
metKK166M |
K166M |
Decrease in AdoMet synthesis |
seeded from UniProt:P0A817 | ||||
|
metKD119N |
D119N |
Decrease of both AdoMet synthesis and AdoMet-activated tripolyphosphate hydrolysis |
seeded from UniProt:P0A817 | ||||
|
metKH15N |
H15N |
Loss of activity |
seeded from UniProt:P0A817 | ||||
|
metKD17N,A |
D17N,A |
Loss of activity |
seeded from UniProt:P0A817 | ||||
|
metKE43K |
E43K |
Misfolding and subject to proteolytic degradation |
seeded from UniProt:P0A817 | ||||
|
metKE43Q |
E43Q |
Loss of stimulation by potassium |
seeded from UniProt:P0A817 | ||||
|
metKC90A,S |
C90A,S |
Decrease in the homotetramer formation capability. Enhanced thermal stability |
seeded from UniProt:P0A817 | ||||
|
metK86 |
Resistant to |
ethionine resistant |
isolation described in materials and methods parent strain: wild-type E. coli K-12 from S. Gross at Duke University | ||||
|
metK110(ts) |
temperature sensitive |
| |||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2909 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGCAAAACACCTTTTTACGTC Primer 2:CCtTTCAGACCGGCAGCATCGCG | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: % [7] | ||
|
Linked marker |
est. P1 cotransduction: 98% [7] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Ferianc, P et al. (1998) The cadmium-stress stimulon of Escherichia coli K-12. Microbiology (Reading, Engl.) 144 ( Pt 4) 1045-50 PubMed
- ↑ Greene, RC et al. (1973) Properties of metK mutants of Escherichia coli K-12. J. Bacteriol. 115 57-67 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 5.0 5.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 6.0 6.1 CGSC: The Coli Genetics Stock Center
- ↑ 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
