lrp:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
| Standard Name |
lrp |
|---|---|
| Gene Synonym(s) |
ECK0880, b0889, JW0872, ihb, livR, lrs, lss, lstR, mbf, oppI, rblA, g[1][2], alsB |
| Product Desc. |
Lrp transcriptional dual regulator[2][3] Global regulatory protein, Leu responsive; regulator of high-affinity branched-chain amino acid transport system; octameric or hexadecameric functional state[4] |
| Product Synonyms(s) |
DNA-binding transcriptional dual regulator, leucine-binding[1], B0889[2][1], LstR[2][1], Mbf[2][1], OppI[2][1], RblA[2][1], Lss[2][1], Lrs[2][1], Ihb[2][1], Lrp[2][1], LivR[2][1], regulator for leucine (or lrp) regulon and high-affinity branched-chain amino acid transport system.[2][1] , alsB, ECK0880, ihb, JW0872, livR, lrs, lss, lstR, mbf, oppI, rblA, b0889 |
| Function from GO |
<GO_nr /> |
| Knock-Out Phenotype | |
| Regulation/Expression | |
| Regulation/Activity | |
| Quick Links | |
| edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
Feast/famine regulatory protein. Homodimers bind adjacent DNA binding sites to form functional octameric state. Lrp wraps DNA and probably plays a role in chromatin organization.[4]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
lrp |
|---|---|
| Mnemonic |
Leucine regulatory protein |
| Synonyms |
ECK0880, b0889, JW0872, ihb, livR, lrs, lss, lstR, mbf, oppI, rblA, g[1][2], alsB |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
20.08 minutes |
MG1655: 931818..932312 |
||
|
NC_012967: 949653..950147 |
||||
|
NC_012759: 834786..835280 |
||||
|
W3110 |
|
W3110: 933017..933511 |
||
|
DH10B: 985746..986240 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
931821 |
Edman degradation |
PMID:2115869 |
| |
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
lrp(del) (Keio:JW0872) |
deletion |
deletion |
PMID:16738554 |
||||
|
lrpD114E |
D114E |
(in lrp-1 mutant) |
Strain variation; seeded from UniProt:P0ACJ0 | ||||
|
lrp-1 |
|||||||
|
lrp-787(del)::kan |
PMID:16738554 |
||||||
|
Irp787(del)::FRT |
Mutagenesis rate |
Decreased stress-induced mutagenesis (SIM) phenotype. |
PMID:23224554 |
Parental Strain: SMR4562 Experimental Strain: PJH1276 |
Mutation Rate was comparatively weak, to other strains, with decrease only happening in 33-67% of wild type population. | ||
|
CAG45114 lrp787(del)::FRTKanFRT |
deletion |
SigmaE activity |
Decrease in SigmaE activity |
PMID:23224554 |
Parental Strain: CAG45114 Experimental Strain: SMR15265 |
See table S11 for full experimental results. | |
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0872 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCGTAGATAGCAAGAAGCGCCC Primer 2:CCGCGCGTCTTAATAACCAGACG | |
|
Kohara Phage |
PMID:3038334 | ||
|
Kohara Phage |
PMID:3038334 | ||
|
Kohara Phage |
PMID:3038334 | ||
|
zbh-29::Tn10 |
Linked marker |
est. P1 cotransduction: % [6] | |
|
zca-1230::Tn10 |
Linked marker |
est. P1 cotransduction: 60% [6] | |
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10547 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10547 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000540 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EchoBASE:EB0542 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0003023 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
Lrp |
|---|---|
| Synonyms |
DNA-binding transcriptional dual regulator, leucine-binding[1], B0889[2][1], LstR[2][1], Mbf[2][1], OppI[2][1], RblA[2][1], Lss[2][1], Lrs[2][1], Ihb[2][1], Lrp[2][1], LivR[2][1], regulator for leucine (or lrp) regulon and high-affinity branched-chain amino acid transport system.[2][1] , alsB, ECK0880, ihb, JW0872, livR, lrs, lss, lstR, mbf, oppI, rblA, b0889 |
| Product description |
Lrp transcriptional dual regulator[2][3] Global regulatory protein, Leu responsive; regulator of high-affinity branched-chain amino acid transport system; octameric or hexadecameric functional state[4] |
| EC number (for enzymes) |
|
| edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
|
GO:0006355 |
regulation of transcription, DNA-dependent |
PMID:12374860 |
IMP: Inferred from Mutant Phenotype |
P |
complete | |||
|
GO:0003677 |
DNA binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0238 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003700 |
transcription factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000485 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003700 |
transcription factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR019885 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003700 |
transcription factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR019887 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003700 |
transcription factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR019888 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005622 |
intracellular |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000485 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005622 |
intracellular |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR019885 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005622 |
intracellular |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR019887 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005622 |
intracellular |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR019888 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006350 |
transcription |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0804 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0043565 |
sequence-specific DNA binding |
PMID:10551881 |
IDA: Inferred from Direct Assay |
F |
complete | |||
|
GO:0006355 |
regulation of transcription, DNA-dependent |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000485 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0043201 |
response to leucine |
PMID:1346534 PMID:12054800 |
IMP: Inferred from Mutant Phenotype |
P |
complete | |||
|
GO:0006355 |
regulation of transcription, DNA-dependent |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR019885 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006355 |
regulation of transcription, DNA-dependent |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR019887 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006355 |
regulation of transcription, DNA-dependent |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR019888 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0043565 |
sequence-specific DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000485 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0043565 |
sequence-specific DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR019885 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0043565 |
sequence-specific DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR019887 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0043565 |
sequence-specific DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR019888 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
| edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
|
Protein |
trxB |
PMID:16606699 |
Experiment(s):EBI-1138286 | |
|
Protein |
nadE |
PMID:16606699 |
Experiment(s):EBI-1138286 | |
|
Protein |
yfhM |
PMID:19402753 |
LCMS(ID Probability):99.0 | |
|
Protein |
nanS |
PMID:19402753 |
LCMS(ID Probability):99.0 | |
| edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Reference/Source | Notes |
|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Name | |
|---|---|
| Sequence |
MVDSKKRPGK DLDRIDRNIL NELQKDGRIS NVELSKRVGL SPTPCLERVR RLERQGFIQG YTALLNPHYL DASLLVFVEI TLNRGAPDVF EQFNTAVQKL EEIQECHLVS GDFDYLLKTR VPDMSAYRKL LGETLLRLPG VNDTRTYVVM EEVKQSNRLV IKTR |
| Length |
164 |
| Mol. Wt |
18.886 kDa |
| pI |
9.1 (calculated) |
| Extinction coefficient |
7,450 - 7,700 (calc based on 5 Y, 0 W, and 2 C residues) |
| edit table |
Domains/Motifs/Modification Sites
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
|
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
ASAP:ABE-0003023 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EcoCyc:EG10547 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10547 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
RegulonDB:ECK120000540 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0542 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|
|
Protein |
E. coli K-12 MC4100 |
1.43E+03 |
molecules/cell |
|
emPAI |
PMID:18304323 | |
|
Protein |
E. coli K-12 MG1655 |
4901 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
5813 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
6729 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
| edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:931798..931838
source=MG1655
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for lrp | |
|
microarray |
Summary of data for lrp from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions Related to lrp Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10547 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0542 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10547 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000540 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0003023 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Anopheles gambiae |
|
From Inparanoid:20070104 |
|
Apis mellifera |
|
From Inparanoid:20070104 |
|
Xenopus tropicalis |
|
From Inparanoid:20070104 |
|
Shigella flexneri |
LRP |
From SHIGELLACYC |
|
E. coli O157 |
LRP |
From ECOO157CYC |
| edit table |
<protect></protect>
Notes
Families
<protect>
See Help:Evolution_families for help entering or editing information in this section of EcoliWiki.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
</protect> <protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 2.15 2.16 2.17 2.18 2.19 2.20 2.21 2.22 2.23 2.24 2.25 2.26 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
Categories


