icd:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
icd |
|---|---|
| Mnemonic |
isocitrate dehydrogenase Isocitrate dehydrogenase |
| Synonyms |
ECK1122, b1136, JW1122, icdA, icdE, icdR[1] |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
25.74 minutes |
MG1655: 1194346..1195596 |
||
|
NC_012967: 1210492..1211742 |
||||
|
NC_012759: 1098271..1099521 |
||||
|
W3110 |
|
W3110: 1196700..1197950 |
||
|
DH10B: 1249791..1251041 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
1194346 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
Δicd (Keio:JW1122) |
deletion |
deletion |
|||||
|
icdY160F |
Y160F |
Large decrease in activity and a small increase in substrate affinity |
seeded from UniProt:P08200 | ||||
|
icdS113D,E |
S113D,E |
Reduced affinity for isocitrate |
seeded from UniProt:P08200 | ||||
|
icdK230M |
K230M |
Decrease in activity and substrate affinity |
seeded from UniProt:P08200 | ||||
|
ΔicdA::kan |
deletion |
Biolog:respiration |
unable to respire L-Fucose |
||||
|
ΔicdA::kan |
deletion |
Biolog:respiration |
unable to respire D-Galactose |
||||
|
ΔicdA::kan |
deletion |
Biolog:respiration |
unable to respire D-Mannose |
||||
|
ΔicdA::kan |
deletion |
Biolog:respiration |
unable to respire b-Methyl-D-glucoside |
||||
|
ΔicdA::kan |
deletion |
Biolog:respiration |
unable to respire D-Sorbitol |
||||
|
ΔicdA::kan |
deletion |
Biolog:respiration |
unable to respire DL-a-Glycerol |
||||
|
ΔicdA::kan |
deletion |
Biolog:respiration |
unable to respire D-Galactoniate |
||||
|
ΔicdA::kan |
deletion |
Biolog:respiration |
unable to respire D-Galacturonate |
||||
|
ΔicdA::kan |
deletion |
Biolog:respiration |
unable to respire D-Gluconate |
||||
|
ΔicdA::kan |
deletion |
Biolog:respiration |
unable to respire D-Glucuronate |
||||
|
ΔicdA::kan |
deletion |
Biolog:respiration |
unable to respire Acetate |
||||
|
ΔicdA::kan |
deletion |
Biolog:respiration |
unable to respire a-Hydroxybutyrate |
||||
|
ΔicdA::kan |
deletion |
Biolog:respiration |
unable to respire a-Ketobutyrate |
||||
|
ΔicdA::kan |
deletion |
Biolog:respiration |
unable to respire a-Ketoglutarate |
||||
|
ΔicdA::kan |
deletion |
Biolog:respiration |
unable to respire DL-Lactate |
||||
|
ΔicdA::kan |
deletion |
Biolog:respiration |
unable to respire Succinate |
||||
|
ΔicdA::kan |
deletion |
Biolog:respiration |
unable to respire L-Alanine |
||||
|
ΔicdA::kan |
deletion |
Biolog:respiration |
unable to respire L-Alanyl-glycine |
||||
|
ΔicdA::kan |
deletion |
Biolog:respiration |
unable to respire L-Asparagine |
||||
|
ΔicdA::kan |
deletion |
Biolog:respiration |
unable to respire L-Aspartate |
||||
|
ΔicdA::kan |
deletion |
Biolog:respiration |
unable to respire D-Serine |
||||
|
ΔicdA::kan |
deletion |
Biolog:respiration |
unable to respire L-Serine |
||||
|
any isocitrate dehydrogenase-deficient mutant |
"Cultures of isocitrate dehydrogenase-deficient (icd) mutants were overgrown by double mutants (icd glt) lacking citrate synthase activity also. The icd mutants grew more slowly than wild-type cells or the double mutants because they accumulated an inhibitory metabolite (possibly citrate)." |
||||||
|
any isocitrate dehydrogenase-deficient mutant |
Resistant to |
Resistant to low levels of nalidixic acid |
|||||
|
icd-11 |
|||||||
|
icd-3 |
|||||||
|
Δicd-724::kan |
| ||||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW1122 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGAAAGTAAAGTAGTTGTTCC Primer 2:CCCATGTTTTCGATGATCGCGTC | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 19% [10] | ||
|
Linked marker |
est. P1 cotransduction: 55% [10] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed
- ↑ 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
- ↑ 5.00 5.01 5.02 5.03 5.04 5.05 5.06 5.07 5.08 5.09 5.10 5.11 5.12 5.13 5.14 5.15 5.16 5.17 5.18 5.19 5.20 5.21 Ito, M et al. (2005) Functional analysis of 1440 Escherichia coli genes using the combination of knock-out library and phenotype microarrays. Metab. Eng. 7 318-27 PubMed
- ↑ 6.0 6.1 Lakshmi, TM & Helling, RB (1976) Selection for citrate synthase deficiency in icd mutants of Escherichia coli. J. Bacteriol. 127 76-83 PubMed
- ↑ Helling, RB & Kukora, JS (1971) Nalidixic acd-resistant mutants of Escherichia coli deficient in isocitrate dehydrogenase. J. Bacteriol. 105 1224-6 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 9.0 9.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 10.0 10.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
