hisI:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
| Standard Name |
hisI |
|---|---|
| Gene Synonym(s) |
ECK2021, b2026, JW2008, hisE, hisIE[1], hisIE |
| Product Desc. |
PR-ATP pyrophosphatase/PR-AMP cyclohydrolase, bifunctional[2] |
| Product Synonyms(s) |
fused phosphoribosyl-AMP cyclohydrolase[1], phosphoribosyl-ATP pyrophosphatase[1], B2026[3][1], HisE[3][1], HisI[3][1] , ECK2021, hisE, hisIE, JW2008, b2026 |
| Function from GO |
<GO_nr /> |
| Knock-Out Phenotype | |
| Regulation/Expression |
transcription unit(s): hisBHAFI[3], hisLGDCBHAFI[3] |
| Regulation/Activity | |
| Quick Links | |
| edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
After four hours of Zn(II) stress, HisJ protein levels decreased (Easton, 2006).[2]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
hisI |
|---|---|
| Mnemonic |
Histidine |
| Synonyms |
ECK2021, b2026, JW2008, hisE, hisIE[1], hisIE |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
45.15 minutes, 45.15 minutes |
MG1655: 2094638..2095249 |
||
|
NC_012967: 2026616..2027227 |
||||
|
NC_012759: 1987121..1987732 |
||||
|
W3110 |
|
W3110: 2098751..2099362 |
||
|
DH10B: 2185646..2186257 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔhisI (Keio:JW2008) |
deletion |
deletion |
Auxotrophies |
Requires histidine for growth |
PMID:16738554 |
||
|
hisITT192GE |
TT192GE |
Auxotrophies |
(in strain: F719) |
Strain variation; seeded from UniProt:P06989 | |||
|
hisIE196D |
E196D |
Auxotrophies |
(in strain: F719) |
Strain variation; seeded from UniProt:P06989 | |||
|
hisI |
Auxotrophies |
Requires Histidine for growth |
Deletion | ||||
|
hisIH164N |
H164N |
Auxotrophies |
(in strain: F719) |
Strain variation; seeded from UniProt:P06989 | |||
|
hisIQ5L |
Q5L |
Auxotrophies |
(in strain: F719) |
Strain variation; seeded from UniProt:P06989 | |||
|
hisIL46I |
L46I |
Auxotrophies |
(in strain: F719) |
Strain variation; seeded from UniProt:P06989 | |||
|
hisIRK199KN |
RK199KN |
Auxotrophies |
(in strain: F719) |
Strain variation; seeded from UniProt:P06989 | |||
|
ΔhisI903 |
deletion |
deletion |
Auxotrophies |
Requires Histidine for growth |
|||
|
ΔhisI724::kan |
deletion |
deletion |
Auxotrophies |
Requires Histidine for growth |
PMID:16738554 |
| |
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2008 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCTTAACAGAACAACAACGTCG Primer 2:CCtTGATGCCGTTTACGCAGGTT | |
|
Kohara Phage |
PMID:3038334 | ||
|
Kohara Phage |
PMID:3038334 | ||
|
zef-3129::Tn10 |
Linked marker |
est. P1 cotransduction: 67% [5] | |
|
Linked marker |
est. P1 cotransduction: % [5] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10451 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10451 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000444 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EchoBASE:EB0446 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0006729 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
HisI |
|---|---|
| Synonyms |
fused phosphoribosyl-AMP cyclohydrolase[1], phosphoribosyl-ATP pyrophosphatase[1], B2026[3][1], HisE[3][1], HisI[3][1] , ECK2021, hisE, hisIE, JW2008, b2026 |
| Product description |
PR-ATP pyrophosphatase/PR-AMP cyclohydrolase, bifunctional[2] |
| EC number (for enzymes) | |
| edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
|
GO:0000105 |
histidine biosynthetic process |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_01019 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0000105 |
histidine biosynthetic process |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR002496 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0000105 |
histidine biosynthetic process |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR008179 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0000105 |
histidine biosynthetic process |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0368 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0000166 |
nucleotide binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0547 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0004635 |
phosphoribosyl-AMP cyclohydrolase activity |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_01019 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0004635 |
phosphoribosyl-AMP cyclohydrolase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR002496 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0004635 |
phosphoribosyl-AMP cyclohydrolase activity |
GOA:spec |
IEA: Inferred from Electronic Annotation |
EC:3.5.4.19 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0004636 |
phosphoribosyl-ATP diphosphatase activity |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_01019 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0004636 |
phosphoribosyl-ATP diphosphatase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR008179 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0004636 |
phosphoribosyl-ATP diphosphatase activity |
GOA:spec |
IEA: Inferred from Electronic Annotation |
EC:3.6.1.31 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005524 |
ATP binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0067 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005737 |
cytoplasm |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_01019 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005737 |
cytoplasm |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0963 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005737 |
cytoplasm |
GO_REF:0000023 |
IEA: Inferred from Electronic Annotation |
SP_SL:SL-0086 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0008652 |
cellular amino acid biosynthetic process |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0028 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
| edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
|
Protein |
rpsE |
PMID:16606699 |
Experiment(s):EBI-1141661 | |
|
Protein |
yagR |
PMID:16606699 |
Experiment(s):EBI-1141661 | |
|
Protein |
yghW |
PMID:16606699 |
Experiment(s):EBI-1141661 | |
|
Protein |
frsA |
PMID:16606699 |
Experiment(s):EBI-1141661 | |
|
Protein |
dld |
PMID:16606699 |
Experiment(s):EBI-1141661 | |
|
Protein |
fpr |
PMID:16606699 |
Experiment(s):EBI-1141661 | |
|
Protein |
mdoG |
PMID:16606699 |
Experiment(s):EBI-1141661 | |
|
Protein |
yjhG |
PMID:16606699 |
Experiment(s):EBI-1141661 | |
|
Protein |
rpsD |
PMID:16606699 |
Experiment(s):EBI-1141661 | |
|
Protein |
manC |
PMID:16606699 |
Experiment(s):EBI-1141661 | |
|
Protein |
cspI |
PMID:16606699 |
Experiment(s):EBI-1141661 | |
|
Protein |
rpsQ |
PMID:16606699 |
Experiment(s):EBI-1141661 | |
|
Protein |
ymfG |
PMID:16606699 |
Experiment(s):EBI-1141661 | |
|
Protein |
prpE |
PMID:16606699 |
Experiment(s):EBI-1141661 | |
|
Protein |
deoA |
PMID:16606699 |
Experiment(s):EBI-1141661 | |
| edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Reference/Source | Notes |
|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Name | |
|---|---|
| Sequence |
MLTEQQRREL DWEKTDGLMP VIVQHAVSGE VLMLGYMNPE ALDKTLESGK VTFFSRTKQR LWTKGETSGN FLNVVSIAPD CDNDTLLVLA NPIGPTCHKG TSSCFGDTAH QWLFLYQLEQ LLAERKSADP ETSYTAKLYA SGTKRIAQKV GEEGVETALA ATVHDRFELT NEASDLMYHL LVLLQDQGLD LTTVIENLRK RHQ |
| Length |
203 |
| Mol. Wt |
22.755 kDa |
| pI |
5.2 (calculated) |
| Extinction coefficient |
23,950 - 24,325 (calc based on 5 Y, 3 W, and 3 C residues) |
| edit table |
Domains/Motifs/Modification Sites
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
|
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
ASAP:ABE-0006729 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EcoCyc:EG10451 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10451 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
RegulonDB:ECK120000444 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0446 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|
|
Protein |
Ecoli K-12 |
0.714+/-0.029 |
Molecules/cell |
|
Single Molecule Fluorescence |
PMID:20671182 | |
|
mRNA |
Ecoli K-12 |
0.081833061 |
Molecules/cell |
|
by RNA_Seq |
PMID:20671182 | |
|
Protein |
E. coli K-12 MG1655 |
2356 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
2042 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
1564 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
| edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:2094618..2094658
source=MG1655
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for hisI | |
|
microarray |
Summary of data for hisI from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions Related to hisI Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10451 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0446 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10451 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000444 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0006729 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Arabidopsis thaliana |
|
From Inparanoid:20070104 |
|
Oryza gramene |
|
From Inparanoid:20070104 |
|
Schizosaccharomyces pombe |
|
From Inparanoid:20070104 |
|
Xenopus tropicalis |
|
From Inparanoid:20070104 |
|
Shigella flexneri |
HISI |
From SHIGELLACYC |
|
E. coli O157 |
HISI |
From ECOO157CYC |
| edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10451 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10451 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000444 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0446 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0006729 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 3.0 3.1 3.2 3.3 3.4 3.5 3.6 3.7 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
- ↑ 5.0 5.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
Categories


