hipA:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
hipA |
|---|---|
| Mnemonic |
High persistence |
| Synonyms |
ECK1500, b1507, JW1500[1], JW1500 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
34.25 minutes |
MG1655: 1590200..1588878 |
||
|
NC_012967: 1568743..1567421 |
||||
|
NC_012759: 1480937..1482259 |
||||
|
W3110 |
|
W3110: 1593890..1592568 |
||
|
DH10B: 1679825..1678503 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔhipA (Keio:JW1500) |
deletion |
deletion |
|||||
|
hipA::Tn5KAN-2 (FB20340) |
Insertion at nt 180 in Plus orientation |
contains pKD46 | |||||
|
hipA::Tn5KAN-2 (FB20341) |
Insertion at nt 180 in Plus orientation |
does not contain pKD46 | |||||
|
hipA7 |
G22S and D291A |
Growth Phenotype |
The hipA7 allele confers a high persistence phenotype and cold sensitivity at 20°C. The HipA7 protein is non-toxic. |
Persisters are cells in a population that survive antibiotic treatment even though genetically they remain sensitive to the antibiotic. Cultures of wild-type cells typically contain 10-5 to 10-6 persister cells. Cultures of hipA7 cells contain 10-2 to 10-3 persister cells. | |||
|
ΔhipA728::kan |
|||||||
|
hipA7 |
G22S and D291A |
presistence frequency |
The hipA7 allele confers a high persistence phenotype. |
experimental strain:HM22 |
Persisters are cells in a population that survive antibiotic treatment even though genetically they remain sensitive to the antibiotic. Cultures of wild-type cells typically contain 10-5 to 10-6 persister cells. Cultures of hipA7 cells contain 10-2 to 10-3 persister cells. | ||
|
hipA9 |
G22S and D291A |
presistence frequency |
The hipA9 allele confers a high persistence phenotype. |
experimental strain:HM23 |
Persisters are cells in a population that survive antibiotic treatment even though genetically they remain sensitive to the antibiotic. Cultures of wild-type cells typically contain 10-5 to 10-6 persister cells. Cultures of hipA9 cells contain 10-2 to 10-3 persister cells. | ||
|
hipA9 |
G22S and D291A |
presistence frequency |
The hipA9 allele confers a high persistence phenotype. |
experimental strain:HM23 |
Persisters are cells in a population that survive antibiotic treatment even though genetically they remain sensitive to the antibiotic. Cultures of wild-type cells typically contain 10-5 to 10-6 persister cells. Cultures of hipA7 cells contain 10-2 to 10-3 persister cells. Refer to figure 3. | ||
|
hipA7 |
G22S and D291A |
presistence frequency |
The hipA7 allele confers a high persistence phenotype. |
experimental strain:HM22 |
Persisters are cells in a population that survive antibiotic treatment even though genetically they remain sensitive to the antibiotic. Cultures of wild-type cells typically contain 10-5 to 10-6 persister cells. Cultures of hipA7 cells contain 10-2 to 10-3 persister cells. | ||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW1500 |
Plasmid clone |
Status:Clone OK Primer 1:GCCCCTAAACTTGTCACTTGGAT Primer 2:CCtTTACTACCGTATTCTCGGCT | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 8% [11] | ||
|
zdi-925::Tn10 |
Linked marker |
est. P1 cotransduction: % [11] | |
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 3.0 3.1 3.2 CGSC: The Coli Genetics Stock Center
- ↑ 4.0 4.1 Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ Korch, SB et al. (2003) Characterization of the hipA7 allele of Escherichia coli and evidence that high persistence is governed by (p)ppGpp synthesis. Mol. Microbiol. 50 1199-213 PubMed
- ↑ 6.0 6.1 Moyed, HS & Bertrand, KP (1983) hipA, a newly recognized gene of Escherichia coli K-12 that affects frequency of persistence after inhibition of murein synthesis. J. Bacteriol. 155 768-75 PubMed
- ↑ Bubbers, JE et al. (1977) Mechanisms of the H-2 effect on viral leukemogenesis. Scand. J. Immunol. 6 533-9 PubMed
- ↑ Wolfson, JS et al. (1990) Mutants of Escherichia coli K-12 exhibiting reduced killing by both quinolone and beta-lactam antimicrobial agents. Antimicrob. Agents Chemother. 34 1938-43 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 10.0 10.1 10.2 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 11.0 11.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
