hdfR:Gene

From EcoliWiki
Jump to: navigation, search

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

<protect>

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

hdfR

Mnemonic

hns-dependent flhDC regulator

Synonyms

ECK3756, b4480, JW5607, yifA, yifD, b3762 (obsolete), apeR?, pssR, b3763 (obsolete)[1][2]

</protect>

Notes

Location(s) and DNA Sequence

[back to top]


<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

85.03 minutes 

MG1655: 3945990..3945151
<gbrowseImage> name=NC_000913:3945151..3945990 source=MG1655 preset=GeneLocation </gbrowseImage>

REL606

NC_012967: 3909767..3908928
<gbrowseImage> name=NC_012967:3908928..3909767 source=REL606 preset=GeneLocation </gbrowseImage>

BW2952

NC_012759: 3834820..3835659
<gbrowseImage> name=NC_012759:3834820..3835659 source=BW2952 preset=GeneLocation </gbrowseImage>

W3110

 

W3110: 3688714..3689553
<gbrowseImage> name=NC_007779:3688714..3689553 source=W3110 preset=GeneLocation </gbrowseImage>

DH10B

DH10B: 4044910..4044071
<gbrowseImage> name=NC_010473:4044071..4044910 source=DH10B preset=GeneLocation </gbrowseImage>

</protect>

Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

<protect></protect>

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

hdfR(del) (Keio:JW5607)

deletion

deletion

PMID:16738554[3]

Shigen

hdfR785(del)::FRT

deletion

Mutagenesis rate

Decrease in Stress Induced Mutagenesis (SIM)

PMID:23224554[4]

Paternal Strain: SMR4562 Experimental Strain: SMR12235

The mutation caused a significant decrease in SIM; Mutant frequency was decreased by over 90 percent. See table S3 for full experimental results.

hdfR785(del)::FRT

deletion

Sensitivity to

SDS-EDTA Sensitivity

PMID:23224554[4]

Paternal Strain: SMR4562 Experimental Strain: SMR12235

The mutation caused an increase in SDS-EDTA sensitivity. See tables S7 and S1 for a summary of experimental data.

hdfR785(del)::FRT

deletion

Sensitivity to

UV Sensitivity

PMID:23224554[4]

Paternal Strain: SMR4562 Experimental Strain: SMR12235

The mutation caused an increase in UV sensitivity. See tables S7 and S1 for a summary of experimental data.

SMR4562 yiaG-yfp FRTcatFRT hdfR785(del)::FRTKanFRT

deletion

SigmaS activity

Decrease in Sigma S activity

PMID:23224554[4]

Parental Strain: SMR10582 Experimental Strain: SMR14261

See table S8 for full experimental results.

<protect></protect>

Notes

Genetic Interactions

[back to top]


<protect>

Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

</protect>

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW5607

Plasmid clone

Shigen

PMID:16769691[5]

Status:Clone OK

Primer 1:GCCGATACGGAATTGTTAAAAAC

Primer 2:CCATACACTTCATCCAGCACGTT

2E6

Kohara Phage

Genobase

PMID:3038334[6]

15D10

Kohara Phage

Genobase

PMID:3038334[6]

rbsD296::Tn10

Linked marker

CAG18501 = CGSC7460[7]

est. P1 cotransduction: 58% [8]
Synonyms:zie-296::Tn10

ilvD500::Tn10

Linked marker

CAG18431 = CGSC7462[7]

est. P1 cotransduction: 77% [8]
Synonyms:ilv500::Tn10

<protect></protect>

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG11449

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG11449

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120001412

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:2847698

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB1418

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0174109

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  3. Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
  4. 4.0 4.1 4.2 4.3 Al Mamun, AA et al. (2012) Identity and function of a large gene network underlying mutagenic repair of DNA breaks. Science 338 1344-8 PubMed
  5. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
  6. 6.0 6.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
  7. 7.0 7.1 CGSC: The Coli Genetics Stock Center
  8. 8.0 8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories