gyrA:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
gyrA |
|---|---|
| Mnemonic |
Gyrase |
| Synonyms |
ECK2223, b2231, JW2225, hisW, nalA, parD, nfxA, norA[1], norA |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
50.32 minutes |
MG1655: 2337442..2334815 |
||
|
NC_012967: 2286120..2283493 |
||||
|
NC_012759: 2220620..2223247 |
||||
|
W3110 |
|
W3110: 2344090..2341463 |
||
|
DH10B: 2428430..2425803 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
2334818 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
gyrAA67S |
A67S |
Resistant to |
(in PPA-10; quinolone-resistant) |
Strain variation; seeded from UniProt:P0AES4 | |||
|
gyrAG81C |
G81C |
(in NAL-97; quinolone-resistant) |
Strain variation; seeded from UniProt:P0AES4 | ||||
|
gyrAD678E |
D678E |
(in strain: 227) |
Strain variation; seeded from UniProt:P0AES4 | ||||
|
gyrAI798IMMI |
I798IMMI |
(in KL-16; quinolone- resistant) |
Strain variation; seeded from UniProt:P0AES4 | ||||
|
gyrAA828S |
A828S |
(in strain: 227) |
Strain variation; seeded from UniProt:P0AES4 | ||||
|
gyrAS83A |
S83A |
Resistant to fluoroquinolones |
seeded from UniProt:P0AES4 | ||||
|
gyrAQ106R |
Q106R |
Resistant to fluoroquinolones |
seeded from UniProt:P0AES4 | ||||
|
gyrAS83W |
S83W |
(in PPA-18 and strain 227; quinolone-resistant) |
Strain variation; seeded from UniProt:P0AES4 | ||||
|
gyrAA84P |
A84P |
(in PPA-05; quinolone-resistant) |
Strain variation; seeded from UniProt:P0AES4 | ||||
|
gyrAD87N |
GAC -> AAC at codon 87 |
D87N |
Resistant to |
(in NAL-113 and KL-16; quinolone- resistant) resistant to 200 ug/ml nalidixic acid |
Strain variation; seeded from UniProt:P0AES4 | ||
|
gyrAQ106H |
Q106H |
(in NAL-89; quinolone-resistant) |
Strain variation; seeded from UniProt:P0AES4 | ||||
|
gyrAD87V |
D87V |
(in strain: 202; quinolone- resistant) |
Strain variation; seeded from UniProt:P0AES4 | ||||
|
gyrAS83L |
S83L |
(in NAL-51, NAL-112, NAL-118 and NAL-119; quinolone-resistant) |
Strain variation; seeded from UniProt:P0AES4 | ||||
|
gyrA98(NalR) |
nalidixic acid resistant |
||||||
|
gyrA20(NalR) |
nalidixic acid resistant |
||||||
|
gyrA12(NalR) |
nalidixic acid resistant |
||||||
|
gyrA26(NalR) |
nalidixic acid resistant |
||||||
|
gyrA39(NalR) |
nalidixic acid resistant |
||||||
|
gyrA96(NalR) |
nalidixic acid resistant |
||||||
|
gyrA91(NalR) |
nalidixic acid resistant |
||||||
|
gyrA93(NalR) |
nalidixic acid resistant |
||||||
|
gyrA216(NalR) |
nalidixic acid resistant |
||||||
|
gyrA220(NalR) |
nalidixic acid resistant |
||||||
|
gyrA218(NalR) |
nalidixic acid resistant |
||||||
|
gyrA13(NalR) |
nalidixic acid resistant |
||||||
|
gyrA19(NalR) |
nalidixic acid resistant |
||||||
|
gyrA111(NalR) |
nalidixic acid resistant |
||||||
|
gyrA261(NalR) |
nalidixic acid resistant |
||||||
|
gyrA90(NalR) |
nalidixic acid resistant |
||||||
|
gyrA99(NalR) |
nalidixic acid resistant |
||||||
|
gyrA49 |
|||||||
|
gyrA217(NalR) |
nalidixic acid resistant |
||||||
|
gyrA223(NalR) |
nalidixic acid resistant |
||||||
|
gyrA219(NalR) |
nalidixic acid resistant |
||||||
|
gyrA271(NalR) |
nalidixic acid resistant |
||||||
|
gyrA260(NalR) |
nalidixic acid resistant |
||||||
|
gyrA270(NalR) |
nalidixic acid resistant |
||||||
|
[gyrA43](ts) |
temperature sensitive |
||||||
|
gyrA25(NalR) |
nalidixic acid resistant |
||||||
|
gyrA21(NalR) |
nalidixic acid resistant |
||||||
|
gyrA222(NalR) |
nalidixic acid resistant |
||||||
|
gyrA29(NalR) |
nalidixic acid resistant |
||||||
|
gyrA17(NalR) |
nalidixic acid resistant |
||||||
|
gyrA42(ts) |
temperature sensitive |
||||||
|
gyrA283(NalR) |
nalidixic acid resistant |
||||||
|
gyrA44(ts) |
temperature sensitive |
||||||
|
gyrA37(NalR) |
nalidixic acid resistant |
||||||
|
gyrA329(NalR) |
nalidixic acid resistant |
||||||
|
gyrA284(NalR) |
nalidixic acid resistant |
||||||
|
gyrA900 |
|||||||
|
gyrA586(NalR) |
nalidixic acid resistant |
||||||
|
gyrA(Am) from OV6 |
Growth Phenotype |
at 42C the separation of DNA into nucleoids and division localization are both disturbed but cells have continued growth and DNA replication production of cells, and normal sized cells are all produced at 42C |
|||||
|
gyrA43(TS) |
Resistant to |
Resistant to Nalidixic Acid at the permissive temperature 32 C. |
Strain: KRF949 Parental Strain: CGSC KNK43
|
||||
|
gyrA43 |
Resistant to |
Resistant to Triazolealanine. |
Strain: KRE449 Parental:CGSC KNK453 |
Results on table 4. | |||
|
nalA mutation in MH5 |
Resistant to |
resistance to nalidixic acid |
similar strain: MH7 resistant at 40ug nal per ml, sensitive at 60ug nal per ml | ||||
|
gyrAR S83L |
S83L |
Resistant to |
Quinolone Resistance |
The mutation conferred an increase in resistance toward Quinolones. See figure 1B. chEBI:23765 | |||
|
gyrAnal-112 |
TCG-->TTG |
S83L |
Resistant to |
Resistant to nalidixic acid |
Parental strain: KL16 |
Results found in Table 1. Mutation and phenotype identical in strains gyrAnal-118, gyrAnal-119, and gyrAnal-51. | |
|
gyrAppa-18 |
TCG-->TGG |
S83W |
Resistant to |
Resistant to pipemidic acid. |
Parental strain: KL16 |
Results found in Table 1. | |
|
gyrAnal-113 |
GAC-->AAC |
D87N |
Resistant to |
Resistant to nalidixic acid |
Parental strain: KL16 |
Results found in Table 1 | |
|
gyrAnal-97 |
GGT-->TGT |
G81C |
Resistant to |
Resistant to nalidixic acid. |
Parental strain: KL16 |
Results found in Table 1. | |
|
gyrAppa-5 |
GCG-->CCG |
A84P |
Resistant to |
Resistant to pipemidic acid. |
PMID 2168148 |
Parental strain: KL16 |
Results found in Table 1. |
|
gyrAppa-10 |
GGC-->TCC |
A67S |
Resistant to |
Resistant to pipemidic acid. |
Parental strain: KL16 |
Results found in Table 1. | |
|
gyrAnal-89 |
CAG-->CAT |
Q106H |
Resistant to |
Resistant to nalidixic acid. |
Parental strain: KL16 |
Results found in Table 1. | |
| edit table |
<protect></protect>
Notes
A Latin American study found that the gyrA single-point mutation has caused E. coli to become resistant to Fluoroquinolones, or antimicrobial drugs. This has resulted in an increase in the number of urinary tract infections. [8]
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2225 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAGCGACCTTGCGAGAGAAAT Primer 2:CCTTCTTCTTCTGGCTCGTCGTC | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 59% [12] | ||
|
Linked marker |
est. P1 cotransduction: 76% [12] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Menzel, R & Gellert, M (1987) Fusions of the Escherichia coli gyrA and gyrB control regions to the galactokinase gene are inducible by coumermycin treatment. J. Bacteriol. 169 1272-8 PubMed
- ↑ Frank, S et al. (1977) Immunocycte stimulation in vitro by nontoxic bacterial lipopolysaccharide derivatives. J. Immunol. 119 855-60 PubMed
- ↑ 4.0 4.1 Rudd, KE & Menzel, R (1987) his operons of Escherichia coli and Salmonella typhimurium are regulated by DNA supercoiling. Proc. Natl. Acad. Sci. U.S.A. 84 517-21 PubMed
- ↑ Hane, MW & Wood, TH (1969) Escherichia coli K-12 mutants resistant to nalidixic acid: genetic mapping and dominance studies. J. Bacteriol. 99 238-41 PubMed
- ↑ Khodursky, AB et al. (1995) Topoisomerase IV is a target of quinolones in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 92 11801-5 PubMed
- ↑ 7.0 7.1 7.2 7.3 7.4 7.5 Yoshida, H et al. (1990) Quinolone resistance-determining region in the DNA gyrase gyrA gene of Escherichia coli. Antimicrob. Agents Chemother. 34 1271-2 PubMed
- ↑ Gales, AC et al. (2000) Occurrence of single-point gyrA mutations among ciprofloxacin-susceptible Escherichia coli isolates causing urinary tract infections in Latin America. Diagn. Microbiol. Infect. Dis. 36 61-4 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 10.0 10.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 11.0 11.1 CGSC: The Coli Genetics Stock Center
- ↑ 12.0 12.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
