{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	grpE
Gene Synonym(s)	ECK2610, b2614, JW2594^[1], JW2594
Product Desc.	phage lambda replication; host DNA synthesis; heat shock protein; protein repair^[2]^[3]; Component of DnaJ/DnaK/GrpE^[2]^[3] Nucleotide exchange factor for the DnaKJ chaperone; heat shock protein; mutant survives lambda induction; stimulates DnaK and HscC ATPase^[4]
Product Synonyms(s)	heat shock protein^[1], B2614^[2]^[1], GrpE^[2]^[1] , ECK2610, JW2594, b2614
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): grpE^[2]
Regulation/Activity
Quick Links
edit table

See Help:Quickview for help with entering information in the Quickview table.

Notes

[back to top]

HT_Cmplx22_Cyt: DnaK+GrpE+GyrA+RpsA.^[4]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	grpE
Mnemonic	Growth after phage induction
Synonyms	ECK2610, b2614, JW2594^[1], JW2594
edit table

Notes

Location(s) and DNA Sequence

[back to top]

See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	59.23 minutes	MG1655: 2748730..2748137 <gbrowseImage> name=NC_000913:2748137..2748730 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 2672003..2671410 <gbrowseImage> name=NC_012967:2671410..2672003 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 2633949..2634542 <gbrowseImage> name=NC_012759:2633949..2634542 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 2749364..2748771 <gbrowseImage> name=NC_007779:2748771..2749364 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 2840495..2839902 <gbrowseImage> name=NC_010473:2839902..2840495 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	AA change(s)	Phenotype: Description	Reference	Availability	Comments
grpEV108A	V108A	No effect in ability to interact with dnaK			seeded from UniProt:P09372
grpEG122D	G122D	Temperature-sensitive phenotype			seeded from UniProt:P09372
grpEL149A	L149A	No effect in ability to interact with dnaK			seeded from UniProt:P09372
grpEQ155A	Q155A	No effect in ability to interact with dnaK			seeded from UniProt:P09372
grpEI157A	I157A	No effect in ability to interact with dnaK			seeded from UniProt:P09372
grpEM159A	M159A	No effect in ability to interact with dnaK			seeded from UniProt:P09372
grpEM174A	M174A	No effect in ability to interact with dnaK			seeded from UniProt:P09372
grpER183A	R183A	Loss of ability to interact with dnaK			seeded from UniProt:P09372
grpER186A	R186A	No effect in ability to interact with dnaK			seeded from UniProt:P09372
grpEM189A	M189A	No effect in ability to interact with dnaK			seeded from UniProt:P09372
grpEV192A	V192A	Loss of ability to interact with dnaK			seeded from UniProt:P09372
grpER74A	R74A	Great decrease in ability to interact with dnaK			seeded from UniProt:P09372
grpEP151A	P151A	No effect in ability to interact with dnaK			seeded from UniProt:P09372
grpER73A	R73A	Great decrease in ability to interact with dnaK			seeded from UniProt:P09372
grpEK82A	K82A	Great decrease in ability to interact with dnaK			seeded from UniProt:P09372
grpEF86A	F86A	No effect in ability to interact with dnaK			seeded from UniProt:P09372
grpER104A	R104A	No effect in ability to interact with dnaK			seeded from UniProt:P09372
grpEE107A	E107A	No effect in ability to interact with dnaK			seeded from UniProt:P09372
grpE280			PMID:2424889	CGSC:90840
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW2594	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCAGTAGTAAAGAACAGAAAAC Primer 2:CCAGCTTTTGCTTTCGCTACAG
E8F2	Kohara Phage	Genobase	PMID:3038334
22D7	Kohara Phage	Genobase	PMID:3038334
pheA18::Tn10	Linked marker	CAG12158 = CGSC7421^[5]	est. P1 cotransduction: 69% ^[6]
srlD3131::Tn10	Linked marker	CAG18642 = CGSC7423^[5]	est. P1 cotransduction: % ^[6] Synonyms:zfh-3131::Tn10, zfi-3131::Tn10
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10416	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10416	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000409	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:947097	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0411	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0008598	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	GrpE
Synonyms	heat shock protein^[1], B2614^[2]^[1], GrpE^[2]^[1] , ECK2610, JW2594, b2614
Product description	phage lambda replication; host DNA synthesis; heat shock protein; protein repair^[2]^[3]; Component of DnaJ/DnaK/GrpE^[2]^[3] Nucleotide exchange factor for the DnaKJ chaperone; heat shock protein; mutant survives lambda induction; stimulates DnaK and HscC ATPase^[4]
EC number (for enzymes)
edit table

Notes

Function

[back to top]

Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0000774	adenyl-nucleotide exchange factor activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000740	F	Seeded from EcoCyc (v14.0)	complete
	GO:0005515	protein binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR009012	F	Seeded from EcoCyc (v14.0)	complete
	GO:0005515	protein binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR013805	F	Seeded from EcoCyc (v14.0)	complete
	GO:0005737	cytoplasm	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_01151	C	Seeded from EcoCyc (v14.0)	complete
	GO:0005737	cytoplasm	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0963	C	Seeded from EcoCyc (v14.0)	complete
	GO:0005737	cytoplasm	GO_REF:0000023	IEA: Inferred from Electronic Annotation	SP_SL:SL-0086	C	Seeded from EcoCyc (v14.0)	complete
	GO:0005739	mitochondrion	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000740	C	Seeded from EcoCyc (v14.0)	complete
	GO:0006457	protein folding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000740	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006457	protein folding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR009012	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006950	response to stress	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0346	P	Seeded from EcoCyc (v14.0)	complete
	GO:0009408	response to heat	PMID:8349564^[7]	IEP: Inferred from Expression Pattern		P		complete
	GO:0030150	protein import into mitochondrial matrix	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000740	P	Seeded from EcoCyc (v14.0)	complete
	GO:0042803	protein homodimerization activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000740	F	Seeded from EcoCyc (v14.0)	complete
	GO:0051087	chaperone binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000740	F	Seeded from EcoCyc (v14.0)	complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	Notes	References	Evidence
Protein	Subunits of DnaJ/DnaK/GrpE	could be indirect
Protein	gadA		PMID:15690043^[8]	Experiment(s):EBI-881166
Protein	metK		PMID:15690043^[8]	Experiment(s):EBI-881166
Protein	mntH		PMID:15690043^[8]	Experiment(s):EBI-888219
Protein	ccmB		PMID:15690043^[8]	Experiment(s):EBI-888219
Protein	dsdX		PMID:15690043^[8]	Experiment(s):EBI-888219
Protein	emrY		PMID:15690043^[8]	Experiment(s):EBI-888219
Protein	evgA		PMID:15690043^[8]	Experiment(s):EBI-888219
Protein	flgK		PMID:15690043^[8]	Experiment(s):EBI-888219
Protein	gadB		PMID:15690043^[8]	Experiment(s):EBI-888219
Protein	rplD		PMID:15690043^[8]	Experiment(s):EBI-888219
Protein	rplL		PMID:15690043^[8]	Experiment(s):EBI-888219
Protein	rplS		PMID:15690043^[8]	Experiment(s):EBI-888219
Protein	rpmG		PMID:15690043^[8]	Experiment(s):EBI-888219
Protein	rpsB		PMID:15690043^[8]	Experiment(s):EBI-888219
Protein	rpsG		PMID:15690043^[8]	Experiment(s):EBI-888219
Protein	sra		PMID:15690043^[8]	Experiment(s):EBI-888219
Protein	thiG		PMID:15690043^[8]	Experiment(s):EBI-888219
Protein	tufA		PMID:15690043^[8]	Experiment(s):EBI-888219
Protein	entB		PMID:15690043^[8]	Experiment(s):EBI-888219
Protein	greA		PMID:16606699^[9]	Experiment(s):EBI-1143469
Protein	paaB		PMID:16606699^[9]	Experiment(s):EBI-1143469
Protein	rplO		PMID:16606699^[9]	Experiment(s):EBI-1143469
Protein	zntR		PMID:16606699^[9]	Experiment(s):EBI-1143469
Protein	rplN		PMID:16606699^[9]	Experiment(s):EBI-1143469
Protein	phnN		PMID:16606699^[9]	Experiment(s):EBI-1143469
Protein	ubiX		PMID:16606699^[9]	Experiment(s):EBI-1143469
Protein	nusG		PMID:16606699^[9]	Experiment(s):EBI-1143469
Protein	clpB		PMID:16606699^[9]	Experiment(s):EBI-1143469
Protein	rplQ		PMID:16606699^[9]	Experiment(s):EBI-1143469
Protein	rplS		PMID:16606699^[9]	Experiment(s):EBI-1143469
Protein	tauB		PMID:16606699^[9]	Experiment(s):EBI-1143469
Protein	rpsE		PMID:16606699^[9]	Experiment(s):EBI-1143469
Protein	rpsI		PMID:16606699^[9]	Experiment(s):EBI-1143469
Protein	fur		PMID:16606699^[9]	Experiment(s):EBI-1143469
Protein	dnaK		PMID:16606699^[9]	Experiment(s):EBI-1143469
Protein	ykgF		PMID:16606699^[9]	Experiment(s):EBI-1143469
Protein	rho		PMID:16606699^[9]	Experiment(s):EBI-1143469
Protein	nadE		PMID:16606699^[9]	Experiment(s):EBI-1143469
Protein	torZ		PMID:16606699^[9]	Experiment(s):EBI-1143469
Protein	matC		PMID:16606699^[9]	Experiment(s):EBI-1143469
Protein	rplJ		PMID:16606699^[9]	Experiment(s):EBI-1143469
Protein	pepD		PMID:16606699^[9]	Experiment(s):EBI-1143469
Protein	lon		PMID:16606699^[9]	Experiment(s):EBI-1143469
Protein	gadB		PMID:19402753^[10]	LCMS(ID Probability):99.0 MALDI(Z-score):7.662561
Protein	thiG		PMID:19402753^[10]	LCMS(ID Probability):99.0
Protein	emrY		PMID:19402753^[10]	LCMS(ID Probability):99.0
Protein	mntH		PMID:19402753^[10]	LCMS(ID Probability):99.0
Protein	dsdX		PMID:19402753^[10]	LCMS(ID Probability):99.0
edit table

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source	Notes
edit table

Notes

Structure and Physical Properties

[back to top]

Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MSSKEQKTPE GQAPEEIIMD QHEEIEAVEP EASAEQVDPR DEKVANLEAQ LAEAQTRERD GILRVKAEME NLRRRTELDI EKAHKFALEK FINELLPVID SLDRALEVAD KANPDMSAMV EGIELTLKSM LDVVRKFGVE VIAETNVPLD PNVHQAIAMV ESDDVAPGNV LGIMQKGYTL NGRTIRAAMV TVAKAKA
Length	197
Mol. Wt	21.797 kDa
pI	4.6 (calculated)
Extinction coefficient	1,490 (calc based on 1 Y, 0 W, and 0 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
Domain	7..194	PF01025 GrpE		PMID:19920124^[11]
edit table

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=grpE taxon=562,83333 </beststructure>

Models

View models at:

edit table

Structure figures

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16130533	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:947097	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0008598	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P09372	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:EG10416	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10416	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:947097	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000409	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0411	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Reference(s)
Protein	E. coli K-12 MC4100	1.60E+04	molecules/cell	Medium: median data from rich and minimal media Temperature (°C): 37 Doubling time (min): Growth Rate(min): Growth phase: other:	emPAI	PMID:18304323
Protein	E. coli K-12 MG1655	23174	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
Protein	E. coli K-12 MG1655	4731	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
Protein	E. coli K-12 MG1655	21080	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
grpE
edit table

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<gbrowseImage> name=NC_000913:2748710..2748750 source=MG1655 flip=1 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b2614 (EcoliWiki Page)	NCBI GEO profiles for grpE
microarray	GenExpDB:b2614 (EcoliWiki Page)	Summary of data for grpE from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
	GFP Fusion	Intergenic region (2748635..2748924) fused to gfpmut2.	OpenBioSystems	GFP fusion described in Zaslaver, et al. Plate:109-AZ17; Well:G1^[12]
edit table

Notes

Accessions Related to grpE Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10416	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0411	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b2614
EcoGene	EcoGene:EG10416	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000409	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0008598	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Anopheles gambiae	ENSANGP00000022118 (score: 1.000; bootstrap: 100%) ENSANGP00000015422 (score: 0.855) ENSANGP00000025924 (score: 0.217)	From Inparanoid:20070104
Apis mellifera	ENSAPMP00000003920 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Arabidopsis thaliana	AT4G26780 (score: 1.000; bootstrap: 87%) AT5G55200 (score: 0.494)	From Inparanoid:20070104
Bos taurus	ENSBTAP00000013431 (score: 1.000; bootstrap: 100%) ENSBTAP00000026575 (score: 0.260)	From Inparanoid:20070104
Caenorhabditis briggsae	WBGene00031315 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Caenorhabditis elegans	WBGene00007927 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Canis familiaris	ENSCAFP00000021192 (score: 1.000; bootstrap: 100%) ENSCAFP00000027030 (score: 0.258)	From Inparanoid:20070104
Danio rerio	ZDB-GENE-051120-111 (score: 1.000; bootstrap: 100%) ZDB-CDNA-051120-47 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Dictyostelium discoideum	DDB0216255 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Drosophila melanogaster	FBgn0014877 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Drosophila pseudoobscura	GA19397-PA (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Gallus gallus	ENSGALP00000025020 (score: 1.000; bootstrap: 100%) ENSGALP00000034032 (score: 0.334)	From Inparanoid:20070104
Homo sapiens	ENSP00000264954 (score: 1.000; bootstrap: 100%) ENSP00000329558 (score: 0.284)	From Inparanoid:20070104
Macaca mulatta	ENSMMUP00000022370 (score: 1.000; bootstrap: 100%) ENSMMUP00000003362 (score: 0.470) ENSMMUP00000028526 (score: 0.307)	From Inparanoid:20070104
Monodelphis domestica	ENSMODP00000003595 (score: 1.000; bootstrap: 100%) ENSMODP00000000081 (score: 1.000; bootstrap: 100%) ENSMODP00000007152 (score: 0.296)	From Inparanoid:20070104
Mus musculus	MGI:1334417 (score: 1.000; bootstrap: 100%) MGI:1334416 (score: 0.216)	From Inparanoid:20070104
Oryza gramene	Q5DPX9 (score: 1.000; bootstrap: 66%) Q6Z0G0 (score: 0.706) Q6EPR4 (score: 0.546) Q5DPX8 (score: 0.515)	From Inparanoid:20070104
Pan troglodytes	ENSPTRP00000027375 (score: 1.000; bootstrap: 100%) ENSPTRP00000029729 (score: 0.284)	From Inparanoid:20070104
Rattus norvegicus	ENSRNOP00000008930 (score: 1.000; bootstrap: 100%) ENSRNOP00000026495 (score: 0.226)	From Inparanoid:20070104
Saccharomyces cerevisiae	YOR232W (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Schizosaccharomyces pombe	SPBC3B99 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Takifugu rubripes	NEWSINFRUP00000131063 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Xenopus tropicalis	ENSXETP00000049520 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Shigella flexneri	GRPE	From SHIGELLACYC
E. coli O157	GRPE	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Pfam (EcoliWiki Page)	PF01025 GrpE
Superfamily (EcoliWiki Page)	SUPERFAMILY:51064
Panther (EcoliWiki Page)	PTHR21237:SF2
Superfamily (EcoliWiki Page)	SUPERFAMILY:58014
EcoCyc	EcoCyc:EG10416	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10416	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000409	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0411	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0008598	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 ^1.5 ^1.6 ^1.7 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.0 ^2.1 ^2.2 ^2.3 ^2.4 ^2.5 ^2.6 ^2.7 ^2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.0 ^3.1 ^3.2 ^3.3 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 ^4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ ^5.0 ^5.1 CGSC: The Coli Genetics Stock Center
↑ ^6.0 ^6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
↑ Chuang, SE & Blattner, FR (1993) Characterization of twenty-six new heat shock genes of Escherichia coli. J. Bacteriol. 175 5242-52 PubMed
↑ ^8.00 ^8.01 ^8.02 ^8.03 ^8.04 ^8.05 ^8.06 ^8.07 ^8.08 ^8.09 ^8.10 ^8.11 ^8.12 ^8.13 ^8.14 ^8.15 ^8.16 ^8.17 ^8.18 Butland, G et al. (2005) Interaction network containing conserved and essential protein complexes in Escherichia coli. Nature 433 531-7 PubMed
↑ ^9.00 ^9.01 ^9.02 ^9.03 ^9.04 ^9.05 ^9.06 ^9.07 ^9.08 ^9.09 ^9.10 ^9.11 ^9.12 ^9.13 ^9.14 ^9.15 ^9.16 ^9.17 ^9.18 ^9.19 ^9.20 ^9.21 ^9.22 ^9.23 Arifuzzaman, M et al. (2006) Large-scale identification of protein-protein interaction of Escherichia coli K-12. Genome Res. 16 686-91 PubMed
↑ ^10.0 ^10.1 ^10.2 ^10.3 ^10.4 Hu, P et al. (2009) Global functional atlas of Escherichia coli encompassing previously uncharacterized proteins. PLoS Biol. 7 e96 PubMed
↑ Finn, RD et al. (2010) The Pfam protein families database. Nucleic Acids Res. 38 D211-22 PubMed
↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed

grpE:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to grpE Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search