grpE:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
| Standard Name |
grpE |
|---|---|
| Gene Synonym(s) |
ECK2610, b2614, JW2594[1], JW2594 |
| Product Desc. |
phage lambda replication; host DNA synthesis; heat shock protein; protein repair[2][3]; Component of DnaJ/DnaK/GrpE[2][3] Nucleotide exchange factor for the DnaKJ chaperone; heat shock protein; mutant survives lambda induction; stimulates DnaK and HscC ATPase[4] |
| Product Synonyms(s) |
heat shock protein[1], B2614[2][1], GrpE[2][1] , ECK2610, JW2594, b2614 |
| Function from GO |
<GO_nr /> |
| Knock-Out Phenotype | |
| Regulation/Expression | |
| Regulation/Activity | |
| Quick Links | |
| edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
HT_Cmplx22_Cyt: DnaK+GrpE+GyrA+RpsA.[4]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
grpE |
|---|---|
| Mnemonic |
Growth after phage induction |
| Synonyms |
ECK2610, b2614, JW2594[1], JW2594 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
59.23 minutes |
MG1655: 2748730..2748137 |
||
|
NC_012967: 2672003..2671410 |
||||
|
NC_012759: 2633949..2634542 |
||||
|
W3110 |
|
W3110: 2749364..2748771 |
||
|
DH10B: 2840495..2839902 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
grpEV108A |
V108A |
No effect in ability to interact with dnaK |
seeded from UniProt:P09372 | ||||
|
grpEG122D |
G122D |
Temperature-sensitive phenotype |
seeded from UniProt:P09372 | ||||
|
grpEL149A |
L149A |
No effect in ability to interact with dnaK |
seeded from UniProt:P09372 | ||||
|
grpEQ155A |
Q155A |
No effect in ability to interact with dnaK |
seeded from UniProt:P09372 | ||||
|
grpEI157A |
I157A |
No effect in ability to interact with dnaK |
seeded from UniProt:P09372 | ||||
|
grpEM159A |
M159A |
No effect in ability to interact with dnaK |
seeded from UniProt:P09372 | ||||
|
grpEM174A |
M174A |
No effect in ability to interact with dnaK |
seeded from UniProt:P09372 | ||||
|
grpER183A |
R183A |
Loss of ability to interact with dnaK |
seeded from UniProt:P09372 | ||||
|
grpER186A |
R186A |
No effect in ability to interact with dnaK |
seeded from UniProt:P09372 | ||||
|
grpEM189A |
M189A |
No effect in ability to interact with dnaK |
seeded from UniProt:P09372 | ||||
|
grpEV192A |
V192A |
Loss of ability to interact with dnaK |
seeded from UniProt:P09372 | ||||
|
grpER74A |
R74A |
Great decrease in ability to interact with dnaK |
seeded from UniProt:P09372 | ||||
|
grpEP151A |
P151A |
No effect in ability to interact with dnaK |
seeded from UniProt:P09372 | ||||
|
grpER73A |
R73A |
Great decrease in ability to interact with dnaK |
seeded from UniProt:P09372 | ||||
|
grpEK82A |
K82A |
Great decrease in ability to interact with dnaK |
seeded from UniProt:P09372 | ||||
|
grpEF86A |
F86A |
No effect in ability to interact with dnaK |
seeded from UniProt:P09372 | ||||
|
grpER104A |
R104A |
No effect in ability to interact with dnaK |
seeded from UniProt:P09372 | ||||
|
grpEE107A |
E107A |
No effect in ability to interact with dnaK |
seeded from UniProt:P09372 | ||||
|
grpE280 |
PMID:2424889 |
| |||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2594 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCAGTAGTAAAGAACAGAAAAC Primer 2:CCAGCTTTTGCTTTCGCTACAG | |
|
Kohara Phage |
PMID:3038334 | ||
|
Kohara Phage |
PMID:3038334 | ||
|
Linked marker |
est. P1 cotransduction: 69% [6] | ||
|
Linked marker |
est. P1 cotransduction: % [6] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10416 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10416 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000409 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EchoBASE:EB0411 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0008598 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
GrpE |
|---|---|
| Synonyms |
heat shock protein[1], B2614[2][1], GrpE[2][1] , ECK2610, JW2594, b2614 |
| Product description |
phage lambda replication; host DNA synthesis; heat shock protein; protein repair[2][3]; Component of DnaJ/DnaK/GrpE[2][3] Nucleotide exchange factor for the DnaKJ chaperone; heat shock protein; mutant survives lambda induction; stimulates DnaK and HscC ATPase[4] |
| EC number (for enzymes) |
|
| edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
|
GO:0000774 |
adenyl-nucleotide exchange factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000740 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005515 |
protein binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR009012 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005515 |
protein binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR013805 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005737 |
cytoplasm |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_01151 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005737 |
cytoplasm |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0963 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005737 |
cytoplasm |
GO_REF:0000023 |
IEA: Inferred from Electronic Annotation |
SP_SL:SL-0086 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005739 |
mitochondrion |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000740 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006457 |
protein folding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000740 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006457 |
protein folding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR009012 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006950 |
response to stress |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0346 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0009408 |
response to heat |
PMID:8349564 |
IEP: Inferred from Expression Pattern |
P |
complete | |||
|
GO:0030150 |
protein import into mitochondrial matrix |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000740 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0042803 |
protein homodimerization activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000740 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0051087 |
chaperone binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000740 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
| edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
|
Protein |
Subunits of DnaJ/DnaK/GrpE |
could be indirect |
||
|
Protein |
gadA |
PMID:15690043 |
Experiment(s):EBI-881166 | |
|
Protein |
metK |
PMID:15690043 |
Experiment(s):EBI-881166 | |
|
Protein |
mntH |
PMID:15690043 |
Experiment(s):EBI-888219 | |
|
Protein |
ccmB |
PMID:15690043 |
Experiment(s):EBI-888219 | |
|
Protein |
dsdX |
PMID:15690043 |
Experiment(s):EBI-888219 | |
|
Protein |
emrY |
PMID:15690043 |
Experiment(s):EBI-888219 | |
|
Protein |
evgA |
PMID:15690043 |
Experiment(s):EBI-888219 | |
|
Protein |
flgK |
PMID:15690043 |
Experiment(s):EBI-888219 | |
|
Protein |
gadB |
PMID:15690043 |
Experiment(s):EBI-888219 | |
|
Protein |
rplD |
PMID:15690043 |
Experiment(s):EBI-888219 | |
|
Protein |
rplL |
PMID:15690043 |
Experiment(s):EBI-888219 | |
|
Protein |
rplS |
PMID:15690043 |
Experiment(s):EBI-888219 | |
|
Protein |
rpmG |
PMID:15690043 |
Experiment(s):EBI-888219 | |
|
Protein |
rpsB |
PMID:15690043 |
Experiment(s):EBI-888219 | |
|
Protein |
rpsG |
PMID:15690043 |
Experiment(s):EBI-888219 | |
|
Protein |
sra |
PMID:15690043 |
Experiment(s):EBI-888219 | |
|
Protein |
thiG |
PMID:15690043 |
Experiment(s):EBI-888219 | |
|
Protein |
tufA |
PMID:15690043 |
Experiment(s):EBI-888219 | |
|
Protein |
entB |
PMID:15690043 |
Experiment(s):EBI-888219 | |
|
Protein |
greA |
PMID:16606699 |
Experiment(s):EBI-1143469 | |
|
Protein |
paaB |
PMID:16606699 |
Experiment(s):EBI-1143469 | |
|
Protein |
rplO |
PMID:16606699 |
Experiment(s):EBI-1143469 | |
|
Protein |
zntR |
PMID:16606699 |
Experiment(s):EBI-1143469 | |
|
Protein |
rplN |
PMID:16606699 |
Experiment(s):EBI-1143469 | |
|
Protein |
phnN |
PMID:16606699 |
Experiment(s):EBI-1143469 | |
|
Protein |
ubiX |
PMID:16606699 |
Experiment(s):EBI-1143469 | |
|
Protein |
nusG |
PMID:16606699 |
Experiment(s):EBI-1143469 | |
|
Protein |
clpB |
PMID:16606699 |
Experiment(s):EBI-1143469 | |
|
Protein |
rplQ |
PMID:16606699 |
Experiment(s):EBI-1143469 | |
|
Protein |
rplS |
PMID:16606699 |
Experiment(s):EBI-1143469 | |
|
Protein |
tauB |
PMID:16606699 |
Experiment(s):EBI-1143469 | |
|
Protein |
rpsE |
PMID:16606699 |
Experiment(s):EBI-1143469 | |
|
Protein |
rpsI |
PMID:16606699 |
Experiment(s):EBI-1143469 | |
|
Protein |
fur |
PMID:16606699 |
Experiment(s):EBI-1143469 | |
|
Protein |
dnaK |
PMID:16606699 |
Experiment(s):EBI-1143469 | |
|
Protein |
ykgF |
PMID:16606699 |
Experiment(s):EBI-1143469 | |
|
Protein |
rho |
PMID:16606699 |
Experiment(s):EBI-1143469 | |
|
Protein |
nadE |
PMID:16606699 |
Experiment(s):EBI-1143469 | |
|
Protein |
torZ |
PMID:16606699 |
Experiment(s):EBI-1143469 | |
|
Protein |
matC |
PMID:16606699 |
Experiment(s):EBI-1143469 | |
|
Protein |
rplJ |
PMID:16606699 |
Experiment(s):EBI-1143469 | |
|
Protein |
pepD |
PMID:16606699 |
Experiment(s):EBI-1143469 | |
|
Protein |
lon |
PMID:16606699 |
Experiment(s):EBI-1143469 | |
|
Protein |
gadB |
PMID:19402753 |
LCMS(ID Probability):99.0 MALDI(Z-score):7.662561 | |
|
Protein |
thiG |
PMID:19402753 |
LCMS(ID Probability):99.0 | |
|
Protein |
emrY |
PMID:19402753 |
LCMS(ID Probability):99.0 | |
|
Protein |
mntH |
PMID:19402753 |
LCMS(ID Probability):99.0 | |
|
Protein |
dsdX |
PMID:19402753 |
LCMS(ID Probability):99.0 | |
| edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Reference/Source | Notes |
|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Name | |
|---|---|
| Sequence |
MSSKEQKTPE GQAPEEIIMD QHEEIEAVEP EASAEQVDPR DEKVANLEAQ LAEAQTRERD GILRVKAEME NLRRRTELDI EKAHKFALEK FINELLPVID SLDRALEVAD KANPDMSAMV EGIELTLKSM LDVVRKFGVE VIAETNVPLD PNVHQAIAMV ESDDVAPGNV LGIMQKGYTL NGRTIRAAMV TVAKAKA |
| Length |
197 |
| Mol. Wt |
21.797 kDa |
| pI |
4.6 (calculated) |
| Extinction coefficient |
1,490 (calc based on 1 Y, 0 W, and 0 C residues) |
| edit table |
Domains/Motifs/Modification Sites
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
|
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
ASAP:ABE-0008598 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EcoCyc:EG10416 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10416 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
RegulonDB:ECK120000409 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0411 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|
|
Protein |
E. coli K-12 MC4100 |
1.60E+04 |
molecules/cell |
|
emPAI |
PMID:18304323 | |
|
Protein |
E. coli K-12 MG1655 |
23174 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
4731 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
21080 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
| edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:2748710..2748750
source=MG1655
flip=1
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for grpE | |
|
microarray |
Summary of data for grpE from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
|
GFP Fusion |
Intergenic region (2748635..2748924) fused to gfpmut2. |
GFP fusion described in Zaslaver, et al. | ||
| edit table |
<protect></protect>
Notes
Accessions Related to grpE Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10416 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0411 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10416 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000409 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0008598 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Anopheles gambiae |
|
From Inparanoid:20070104 |
|
Apis mellifera |
|
From Inparanoid:20070104 |
|
Arabidopsis thaliana |
|
From Inparanoid:20070104 |
|
Bos taurus |
|
From Inparanoid:20070104 |
|
Caenorhabditis briggsae |
|
From Inparanoid:20070104 |
|
Caenorhabditis elegans |
|
From Inparanoid:20070104 |
|
Canis familiaris |
|
From Inparanoid:20070104 |
|
Danio rerio |
|
From Inparanoid:20070104 |
|
Dictyostelium discoideum |
|
From Inparanoid:20070104 |
|
Drosophila melanogaster |
|
From Inparanoid:20070104 |
|
Drosophila pseudoobscura |
|
From Inparanoid:20070104 |
|
Gallus gallus |
|
From Inparanoid:20070104 |
|
Homo sapiens |
|
From Inparanoid:20070104 |
|
Macaca mulatta |
|
From Inparanoid:20070104 |
|
Monodelphis domestica |
|
From Inparanoid:20070104 |
|
Mus musculus |
|
From Inparanoid:20070104 |
|
Oryza gramene |
|
From Inparanoid:20070104 |
|
Pan troglodytes |
|
From Inparanoid:20070104 |
|
Rattus norvegicus |
|
From Inparanoid:20070104 |
|
Saccharomyces cerevisiae |
|
From Inparanoid:20070104 |
|
Schizosaccharomyces pombe |
|
From Inparanoid:20070104 |
|
Takifugu rubripes |
|
From Inparanoid:20070104 |
|
Xenopus tropicalis |
|
From Inparanoid:20070104 |
|
Shigella flexneri |
GRPE |
From SHIGELLACYC |
|
E. coli O157 |
GRPE |
From ECOO157CYC |
| edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10416 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10416 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000409 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0411 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0008598 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 3.3 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed
Categories
- Genes in OpenBioSystems with Promoter Fusions
- Genes with homologs in Anopheles gambiae
- Genes with homologs in Apis mellifera
- Genes with homologs in Arabidopsis thaliana
- Genes with homologs in Bos taurus
- Genes with homologs in Caenorhabditis briggsae
- Genes with homologs in Caenorhabditis elegans
- Genes with homologs in Canis familiaris
- Genes with homologs in Danio rerio
- Genes with homologs in Dictyostelium discoideum
- Genes with homologs in Drosophila melanogaster
- Genes with homologs in Drosophila pseudoobscura
- Genes with homologs in Gallus gallus
- Genes with homologs in Homo sapiens
- Genes with homologs in Macaca mulatta
- Genes with homologs in Monodelphis domestica
- Genes with homologs in Mus musculus
- Genes with homologs in Oryza gramene
- Genes with homologs in Pan troglodytes
- Genes with homologs in Rattus norvegicus
- Genes with homologs in Saccharomyces cerevisiae
- Genes with homologs in Schizosaccharomyces pombe
- Genes with homologs in Takifugu rubripes
- Genes with homologs in Xenopus tropicalis
- Genes with homologs in Shigella flexneri
- Genes with homologs in E. coli O157


