glnH:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
| Standard Name |
glnH |
|---|---|
| Gene Synonym(s) |
ECK0800, b0811, JW0796[1], JW0796 |
| Product Desc. |
Component of glutamine ABC transporter[2][3] Periplasmic glutamine-binding protein[4] |
| Product Synonyms(s) |
glutamine transporter subunit[1], periplasmic binding component of ABC superfamily[1], B0811[2][1], GlnH[2][1] , ECK0800, JW0796, b0811 |
| Function from GO |
<GO_nr /> |
| Knock-Out Phenotype | |
| Regulation/Expression | |
| Regulation/Activity | |
| Quick Links | |
| edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
After four hours of Zn(II) stress, GlnH protein levels decreased; glnH mispelled as ginH (Easton, 2006).[4]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
glnH |
|---|---|
| Mnemonic |
Glutamine |
| Synonyms |
ECK0800, b0811, JW0796[1], JW0796 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
18.24 minutes |
MG1655: 847227..846481 |
||
|
NC_012967: 840629..839883 |
||||
|
NC_012759: 749449..750195 |
||||
|
W3110 |
|
W3110: 848426..847680 |
||
|
DH10B: 901155..900409 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
846484 |
Edman degradation |
PMID:3027504 |
| |
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔglnH (Keio:JW0796) |
deletion |
deletion |
PMID:16738554 |
||||
|
glnH10(Const) |
constitutive |
||||||
|
ΔglnH783::kan |
PMID:16738554 |
| |||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0796 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCAAGTCTGTATTAAAAGTTTC Primer 2:CCTTTCGGTTCAGTACCGAACCA | |
|
Kohara Phage |
PMID:3038334 | ||
|
Kohara Phage |
PMID:3038334 | ||
|
zbh-29::Tn10 |
Linked marker |
est. P1 cotransduction: 39% [6] | |
|
zca-1230::Tn10 |
Linked marker |
est. P1 cotransduction: % [6] | |
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10386 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10386 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000379 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EchoBASE:EB0381 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0002771 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
GlnH |
|---|---|
| Synonyms |
glutamine transporter subunit[1], periplasmic binding component of ABC superfamily[1], B0811[2][1], GlnH[2][1] , ECK0800, JW0796, b0811 |
| Product description |
Component of glutamine ABC transporter[2][3] Periplasmic glutamine-binding protein[4] |
| EC number (for enzymes) |
|
| edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
|
GO:0005215 |
transporter activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001638 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005215 |
transporter activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR005768 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005215 |
transporter activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR018313 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006810 |
transport |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001638 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006810 |
transport |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR005768 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006810 |
transport |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR018313 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006810 |
transport |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0813 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006865 |
amino acid transport |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0029 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0030288 |
outer membrane-bounded periplasmic space |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001638 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0030288 |
outer membrane-bounded periplasmic space |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR005768 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0030288 |
outer membrane-bounded periplasmic space |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR018313 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0042597 |
periplasmic space |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0574 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0042597 |
periplasmic space |
GO_REF:0000023 |
IEA: Inferred from Electronic Annotation |
SP_SL:SL-0200 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
| edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
|
Protein |
Subunits of glutamine ABC transporter |
could be indirect |
||
|
Protein |
ydcP |
PMID:16606699 |
Experiment(s):EBI-1138080 | |
| edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Reference/Source | Notes |
|---|---|---|---|---|
|
periplasm |
From EcoCyc[3] |
|||
|
Periplasm |
PMID:9298646 |
| ||
| edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Name | |
|---|---|
| Sequence |
MKSVLKVSLA ALTLAFAVSS HAADKKLVVA TDTAFVPFEF KQGDKYVGFD VDLWAAIAKE LKLDYELKPM DFSGIIPALQ TKNVDLALAG ITITDERKKA IDFSDGYYKS GLLVMVKANN NDVKSVKDLD GKVVAVKSGT GSVDYAKANI KTKDLRQFPN IDNAYMELGT NRADAVLHDT PNILYFIKTA GNGQFKAVGD SLEAQQYGIA FPKGSDELRD KVNGALKTLR ENGTYNEIYK KWFGTEPK |
| Length |
248 |
| Mol. Wt |
27.19 kDa |
| pI |
8.9 (calculated) |
| Extinction coefficient |
25,900 (calc based on 10 Y, 2 W, and 0 C residues) |
| edit table |
Domains/Motifs/Modification Sites
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
|
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
ASAP:ABE-0002771 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EcoCyc:EG10386 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10386 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
RegulonDB:ECK120000379 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0381 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|
|
Protein |
E. coli K-12 MC4100 |
1.04E+03 |
molecules/cell |
|
emPAI |
PMID:18304323 | |
|
Protein |
E. coli K-12 MG1655 |
627 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
3566 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
564 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
| edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:847207..847247
source=MG1655
flip=1
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for glnH | |
|
microarray |
Summary of data for glnH from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
|
GFP Fusion |
Intergenic region (847129..847713) fused to gfpmut2. |
GFP fusion described in Zaslaver, et al. | ||
| edit table |
<protect></protect>
Notes
Accessions Related to glnH Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10386 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0381 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10386 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000379 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0002771 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Apis mellifera |
|
From Inparanoid:20070104 |
|
Arabidopsis thaliana |
|
From Inparanoid:20070104 |
|
Bos taurus |
|
From Inparanoid:20070104 |
|
Caenorhabditis briggsae |
|
From Inparanoid:20070104 |
|
Caenorhabditis elegans |
|
From Inparanoid:20070104 |
|
Canis familiaris |
|
From Inparanoid:20070104 |
|
Ciona intestinalis |
|
From Inparanoid:20070104 |
|
Danio rerio |
|
From Inparanoid:20070104 |
|
Drosophila melanogaster |
|
From Inparanoid:20070104 |
|
Drosophila pseudoobscura |
|
From Inparanoid:20070104 |
|
Gallus gallus |
|
From Inparanoid:20070104 |
|
Homo sapiens |
|
From Inparanoid:20070104 |
|
Macaca mulatta |
|
From Inparanoid:20070104 |
|
Monodelphis domestica |
|
From Inparanoid:20070104 |
|
Mus musculus |
|
From Inparanoid:20070104 |
|
Oryza gramene |
|
From Inparanoid:20070104 |
|
Pan troglodytes |
|
From Inparanoid:20070104 |
|
Rattus norvegicus |
|
From Inparanoid:20070104 |
|
Takifugu rubripes |
|
From Inparanoid:20070104 |
|
Tetraodon nigroviridis |
|
From Inparanoid:20070104 |
|
Xenopus tropicalis |
|
From Inparanoid:20070104 |
|
Shigella flexneri |
GLNH |
From SHIGELLACYC |
|
E. coli O157 |
GLNH |
From ECOO157CYC |
| edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
PF00497 Bacterial extracellular solute-binding proteins, family 3 |
||
|
EcoCyc:EG10386 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10386 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000379 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0381 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0002771 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 1.9 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 3.3 3.4 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed
Categories
- Genes in OpenBioSystems with Promoter Fusions
- Genes with homologs in Apis mellifera
- Genes with homologs in Arabidopsis thaliana
- Genes with homologs in Bos taurus
- Genes with homologs in Caenorhabditis briggsae
- Genes with homologs in Caenorhabditis elegans
- Genes with homologs in Canis familiaris
- Genes with homologs in Ciona intestinalis
- Genes with homologs in Danio rerio
- Genes with homologs in Drosophila melanogaster
- Genes with homologs in Drosophila pseudoobscura
- Genes with homologs in Gallus gallus
- Genes with homologs in Homo sapiens
- Genes with homologs in Macaca mulatta
- Genes with homologs in Monodelphis domestica
- Genes with homologs in Mus musculus
- Genes with homologs in Oryza gramene
- Genes with homologs in Pan troglodytes
- Genes with homologs in Rattus norvegicus
- Genes with homologs in Takifugu rubripes
- Genes with homologs in Tetraodon nigroviridis
- Genes with homologs in Xenopus tropicalis
- Genes with homologs in Shigella flexneri
- Genes with homologs in E. coli O157


