galU:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
galU |
---|---|
Mnemonic |
Galactose |
Synonyms |
ECK1231, b1236, JW1224, ychD, verA[1], verA |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
27.82 minutes |
MG1655: 1290680..1291588 |
||
NC_012967: 1291251..1292159 |
||||
NC_012759: 1180178..1181086 |
||||
W3110 |
|
W3110: 1293034..1293942 |
||
DH10B: 1330921..1331829 |
||||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
Coding Start (SO:0000323) |
1290683 |
Edman degradation |
| ||
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
galU(del) (Keio:JW1224) |
deletion |
deletion |
|||||
galU51 |
|||||||
galU65 |
|||||||
galU106 |
|||||||
galU95 |
|||||||
galU50 |
|||||||
galU43 |
|||||||
galU536 |
|||||||
galU745(del)::kan |
|||||||
galU in strain D21 |
Resistant to |
ampicillin resistance |
D21 |
||||
galU (DEL) |
deletion |
Resistant to |
resistant to Ampicillin up to 10 micrograms per milliliter. |
Strain D21e8 Parent Strain D21 |
Table 1 | ||
galU (DEL) |
deletion |
Resistant to |
resistant to up to 10 milligrams per milliliter of Sodium cholate |
Strain D21e8 Parent Strain D21 |
Table 1 | ||
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW1224 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGCTGCCATTAATACGAAAGT Primer 2:CCCTTCTTAATGCCCATCTCTTC | |
Kohara Phage |
|||
Kohara Phage |
|||
Kohara Phage |
|||
Linked marker |
est. P1 cotransduction: 6% [10] | ||
Linked marker |
est. P1 cotransduction: 63% [10] | ||
W4597 |
Strain |
has no UDPG phosphorylase (Table 1) |
|
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Hossain, SA et al. (1994) Overproduction and characterization of recombinant UDP-glucose pyrophosphorylase from Escherichia coli K-12. J. Biochem. 115 965-72 PubMed
- ↑ Weissborn, AC et al. (1994) UTP: alpha-D-glucose-1-phosphate uridylyltransferase of Escherichia coli: isolation and DNA sequence of the galU gene and purification of the enzyme. J. Bacteriol. 176 2611-8 PubMed
- ↑ Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed
- ↑ 5.0 5.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 6.0 6.1 6.2 CGSC: The Coli Genetics Stock Center
- ↑ 7.0 7.1 7.2 Eriksson-Grennberg, KR et al. (1971) Resistance of Escherichia coli to penicillins. IX. Genetics and physiology of class II ampicillin-resistant mutants that are galactose negative or sensitive to bacteriophage C21, or both. J. Bacteriol. 108 1210-23 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 9.0 9.1 9.2 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 10.0 10.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Buchanan, CE & Markovitz, A (1973) Derepression of uridine diphosphate-glucose pyrophosphorylase (galU) in capR(lon), capS, and capT mutants and studies on the galU repressor. J. Bacteriol. 115 1011-20 PubMed