galK:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
galK |
|---|---|
| Mnemonic |
Galactose |
| Synonyms |
ECK0746, b0757, JW0740, galA[1], galA |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
16.99 minutes |
MG1655: 789202..788054 |
||
|
NC_012967: 770608..769460 |
||||
|
NC_012759: 691022..692170 |
||||
|
W3110 |
|
W3110: 790401..789253 |
||
|
DH10B: 843130..840646 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
788057 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔgalK (Keio:JW0740) |
deletion |
deletion |
|||||
|
galK::Tn5KAN-2 (FB20232) |
Insertion at nt 850 in Plus orientation |
does not contain pKD46 | |||||
|
ΔgalK2 |
E coli bacteria was treated with UV radiation to induce mutation in galactose pathway [6] |
Galactose is broken down through α-galactose-1-phosphate(GAL-1-P), uridine diphosphogalactose (UDPGal), and uridine diphosphoglucose (UDPG). Three enzymes are used to convert galactose to glycolytic intermediate. Under incubation, galactose mutants were given galactose and ATP and researchers measured the production of galactose-1-phosphate to determine galactokinase activity. Galactose negative mutants showed no galactokinase activity and therefore no production of galacose-1-phosphate. [7] |
|||||
|
galK2(Oc) |
ochre (UAA) mutation | ||||||
|
galK35 |
|||||||
|
galK30 |
|||||||
|
galK16 |
|||||||
|
galK42(Am) |
amber (UAG) mutation | ||||||
|
galK48 |
|||||||
|
galK8 |
|||||||
|
galK0 |
|||||||
|
galK900 |
|||||||
|
galK24 |
|||||||
|
galK62 |
|||||||
|
ΔgalK729::kan |
| ||||||
| edit table |
<protect></protect>
Notes
Notice: no direct refrence to the isolation of galactose negative mutants of galactokinase 2. Direct publication not identified for galactokinase 2. This shows the isolation of galactokinase mutants, but it should have been found in similar manner. Galk2 mutation is a newer discovery and not quite clear yet.
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0740 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAGTCTGAAAGAAAAAACACA Primer 2:CCGCACTGTCCTGCTCCTTGTGA | |
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 75% [11] | ||
|
zbh-29::Tn10 |
Linked marker |
est. P1 cotransduction: 27% [11] | |
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Schlesinger, DH et al. (1977) The NH2-terminal sequences of galactokinase from Escherichia coli and Saccharomyces cerevisiae. FEBS Lett. 83 45-7 PubMed
- ↑ 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
- ↑ Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ 6.0 6.1 Morse, ML et al. (1956) Transduction in Escherichia Coli K-12. Genetics 41 142-56 PubMed
- ↑ 7.0 7.1 KURAHASHI, K (1957) Enzyme formation in galactose-negative mutants of Escherichia coli. Science 125 114-6 PubMed
- ↑ Oller, AR et al. (1993) The Escherichia coli galK2 papillation assay: its specificity and application to seven newly isolated mutator strains. Mutat. Res. 292 175-85 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 11.0 11.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
