frdB:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Standard Name |
frdB |
---|---|
Gene Synonym(s) |
ECK4149, b4153, JW4114[1], JW4114 |
Product Desc. |
fumarate reductase iron-sulfur protein[2][3]; Component of fumarate reductase[2][3] Fumarate reductase iron-sulfur protein subunit[4] |
Product Synonyms(s) |
fumarate reductase (anaerobic), Fe-S subunit[1], B4153[2][1], FrdB[2][1] , ECK4149, JW4114, b4153 |
Function from GO |
<GO_nr /> |
Knock-Out Phenotype | |
Regulation/Expression | |
Regulation/Activity | |
Quick Links | |
edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
HT_Cmplx15_Mem: FrdA+FrdB.[4]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
frdB |
---|---|
Mnemonic |
Fumarate reductase |
Synonyms |
ECK4149, b4153, JW4114[1], JW4114 |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
94.36 minutes, 94.36 minutes |
MG1655: 4378540..4377806 |
||
NC_012967: 4359228..4358494 |
||||
NC_012759: 4316541..4317275 |
||||
W3110 |
|
W3110: 4385197..4384463 |
||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
Coding Start (SO:0000323) |
4377809 |
Edman degradation |
PMID:6751816 |
| |
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
Strain DH10B |
D51N |
Nonsynonomous mutation |
PMID:18245285 |
This is a SNP in E. coli K-12 Strain DH10B | |||
ΔfrdB (Keio:JW4114) |
deletion |
deletion |
PMID:16738554 |
||||
frdBC58S |
C58S |
Affects center 1 (2Fe-2S) |
seeded from UniProt:P0AC47 | ||||
frdBC78S |
C78S |
Affects center 1 (2Fe-2S) |
seeded from UniProt:P0AC47 | ||||
frdBC63S |
C63S |
Affects center 1 (2Fe-2S) |
seeded from UniProt:P0AC47 | ||||
frdBC66S |
C66S |
Affects center 1 (2Fe-2S) |
seeded from UniProt:P0AC47 | ||||
ΔfrdB780::kan |
PMID:16738554 |
| |||||
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW4114 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCGCTGAGATGAAAAACCTGAA Primer 2:CCGCGTGGTTTCAGGGTCGCGAT | |
Kohara Phage |
PMID:3038334 | ||
Kohara Phage |
PMID:3038334 | ||
Linked marker |
est. P1 cotransduction: 46% [6] | ||
Linked marker |
est. P1 cotransduction: 11% [6] | ||
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10331 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10331 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000325 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EchoBASE:EB0327 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0013602 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
Standard name |
FrdB |
---|---|
Synonyms |
fumarate reductase (anaerobic), Fe-S subunit[1], B4153[2][1], FrdB[2][1] , ECK4149, JW4114, b4153 |
Product description |
fumarate reductase iron-sulfur protein[2][3]; Component of fumarate reductase[2][3] Fumarate reductase iron-sulfur protein subunit[4] |
EC number (for enzymes) | |
edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
---|---|---|---|---|---|---|---|---|
GO:0000104 |
succinate dehydrogenase activity |
GOA:spec |
IEA: Inferred from Electronic Annotation |
EC:1.3.99.1 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0001539 |
ciliary or flagellar motility |
PMID:18337747 |
IMP: Inferred from Mutant Phenotype |
P |
Seeded from EcoCyc (v14.0) |
complete | ||
GO:0005506 |
iron ion binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0408 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005737 |
cytoplasm |
PMID:10373108 |
IDA: Inferred from Direct Assay |
C |
Seeded from EcoCyc (v14.0) |
complete | ||
GO:0006099 |
tricarboxylic acid cycle |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR004489 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006099 |
tricarboxylic acid cycle |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0816 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006113 |
fermentation |
PMID:14109218 |
IMP: Inferred from Mutant Phenotype |
P |
Seeded from EcoCyc (v14.0) |
complete | ||
GO:0006810 |
transport |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0813 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0009055 |
electron carrier activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001041 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0009055 |
electron carrier activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR006058 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0009055 |
electron carrier activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR017900 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0009055 |
electron carrier activity |
PMID:8499449 |
IDA: Inferred from Direct Assay |
F |
Seeded from EcoCyc (v14.0) |
complete | ||
GO:0009061 |
anaerobic respiration |
PMID:14109218 |
IMP: Inferred from Mutant Phenotype |
P |
Seeded from EcoCyc (v14.0) |
complete | ||
GO:0009296 |
flagellum assembly |
PMID:18337747 |
IMP: Inferred from Mutant Phenotype |
P |
Seeded from EcoCyc (v14.0) |
complete | ||
GO:0016020 |
membrane |
PMID:16858726 |
IDA: Inferred from Direct Assay |
C |
Seeded from EcoCyc (v14.0) |
complete | ||
GO:0016491 |
oxidoreductase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR004489 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016491 |
oxidoreductase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR009051 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016491 |
oxidoreductase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR012285 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016491 |
oxidoreductase activity |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0560 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0022900 |
electron transport chain |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0249 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0046872 |
metal ion binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0479 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0051537 |
2 iron, 2 sulfur cluster binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0001 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0051537 |
2 iron, 2 sulfur cluster binding |
PMID:10373108 |
IDA: Inferred from Direct Assay |
F |
Seeded from EcoCyc (v14.0) |
complete | ||
GO:0051538 |
3 iron, 4 sulfur cluster binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0003 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0051538 |
3 iron, 4 sulfur cluster binding |
PMID:10373108 |
IDA: Inferred from Direct Assay |
F |
Seeded from EcoCyc (v14.0) |
complete | ||
GO:0051539 |
4 iron, 4 sulfur cluster binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0004 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0051539 |
4 iron, 4 sulfur cluster binding |
PMID:10373108 |
IDA: Inferred from Direct Assay |
F |
Seeded from EcoCyc (v14.0) |
complete | ||
GO:0055114 |
oxidation reduction |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR004489 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0055114 |
oxidation reduction |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR009051 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0055114 |
oxidation reduction |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0560 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
Partner Type | Partner | Notes | References | Evidence |
---|---|---|---|---|
Protein |
Subunits of fumarate reductase |
could be indirect |
| |
edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
Compartment | Description | Evidence | Reference/Source | Notes |
---|---|---|---|---|
Cytoplasm |
PMID:8419359, PMID:6751816 |
| ||
edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
Name | |
---|---|
Sequence |
MAEMKNLKIE VVRYNPEVDT APHSAFYEVP YDATTSLLDA LGYIKDNLAP DLSYRWSCRM AICGSCGMMV NNVPKLACKT FLRDYTDGMK VEALANFPIE RDLVVDMTHF IESLEAIKPY IIGNSRTADQ GTNIQTPAQM AKYHQFSGCI NCGLCYAACP QFGLNPEFIG PAAITLAHRY NEDSRDHGKK ERMAQLNSQN GVWSCTFVGY CSEVCPKHVD PAAAIQQGKV ESSKDFLIAT LKPR |
Length |
244 |
Mol. Wt |
27.122 kDa |
pI |
6.5 (calculated) |
Extinction coefficient |
27,390 - 28,765 (calc based on 11 Y, 2 W, and 11 C residues) |
edit table |
Domains/Motifs/Modification Sites
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
Resource type | Source | Notes/Reference |
---|---|---|
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
ASAP:ABE-0013602 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EcoCyc:EG10331 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10331 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
RegulonDB:ECK120000325 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0327 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
---|---|---|---|---|---|---|---|
Protein |
E. coli K-12 MG1655 |
404 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
144 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
318 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
![]() Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:4378520..4378560
source=MG1655
flip=1
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
Allele Name | Mutation | Phenotype | Reference |
---|---|---|---|
edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
Type | Reference | Notes |
---|---|---|
microarray |
NCBI GEO profiles for frdB | |
microarray |
Summary of data for frdB from multiple microarray studies | |
edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
Resource Name | Resource Type | Description | Source | Notes |
---|---|---|---|---|
edit table |
<protect></protect>
Notes
Accessions Related to frdB Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10331 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0327 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10331 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000325 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0013602 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
Organism | Homologs (Statistics) | Comments |
---|---|---|
Shigella flexneri |
FRDB |
From SHIGELLACYC |
E. coli O157 |
FRDB |
From ECOO157CYC |
edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10331 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10331 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000325 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0327 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0013602 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 3.3 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
Categories