flu:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
flu |
|---|---|
| Mnemonic |
Flagella |
| Synonyms |
ECK1993, b2000, JW1982, agn43, agn, yeeQ, yzzX[1], yzzX |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
44.61 minutes |
MG1655: 2069563..2072682 |
||
|
NC_012967: 2999564..3002410 |
||||
|
NC_012759: 1962046..1965165 |
||||
|
W3110 |
|
W3110: 2073676..2076795 |
||
|
DH10B: 2160571..2163690 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
2069719 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
fluLNLVHTS829MNLIYNA |
LNLVHTS829MNLIYNA |
(in strain: ML 308- 225) |
Strain variation; seeded from UniProt:P39180 | ||||
|
fluATN303STI |
ATN303STI |
(in strain: ML 308-225) |
Strain variation; seeded from UniProt:P39180 | ||||
|
fluA320T |
A320T |
(in strain: ML 308-225) |
Strain variation; seeded from UniProt:P39180 | ||||
|
fluQGT845LGA |
QGT845LGA |
(in strain: ML 308-225) |
Strain variation; seeded from UniProt:P39180 | ||||
|
fluS855T |
S855T |
(in strain: ML 308-225) |
Strain variation; seeded from UniProt:P39180 | ||||
|
fluQ888L |
Q888L |
(in strain: ML 308-225) |
Strain variation; seeded from UniProt:P39180 | ||||
|
fluS1025I |
S1025I |
(in strain: ML 308-225) |
Strain variation; seeded from UniProt:P39180 | ||||
|
fluA815V |
A815V |
(in strain: ML 308-225) |
Strain variation; seeded from UniProt:P39180 | ||||
|
fluH585Y |
H585Y |
(in strain: ML 308-225) |
Strain variation; seeded from UniProt:P39180 | ||||
|
fluE709K |
E709K |
(in strain: ML 308-225) |
Strain variation; seeded from UniProt:P39180 | ||||
|
fluM721T |
M721T |
(in strain: ML 308-225) |
Strain variation; seeded from UniProt:P39180 | ||||
|
fluGHL751SHF |
GHL751SHF |
(in strain: ML 308-225) |
Strain variation; seeded from UniProt:P39180 | ||||
|
fluS803P |
S803P |
(in strain: ML 308-225) |
Strain variation; seeded from UniProt:P39180 | ||||
|
fluN372Q |
N372Q |
(in strain: ML 308-225) |
Strain variation; seeded from UniProt:P39180 | ||||
|
fluE493V |
E493V |
(in strain: ML 308-225) |
Strain variation; seeded from UniProt:P39180 | ||||
|
fluS497N |
S497N |
(in strain: ML 308-225) |
Strain variation; seeded from UniProt:P39180 | ||||
|
fluW157L |
W157L |
(in strain: ML 308-225) |
Strain variation; seeded from UniProt:P39180 | ||||
|
fluV188F |
V188F |
(in strain: ML 308-225) |
Strain variation; seeded from UniProt:P39180 | ||||
|
fluT46K |
T46K |
(in strain: ML 308-225) |
Strain variation; seeded from UniProt:P39180 | ||||
|
fluK2N |
K2N |
(in strain: ML 308-225) |
Strain variation; seeded from UniProt:P39180 | ||||
|
fluSL41FF |
SL41FF |
(in strain: ML 308-225) |
Strain variation; seeded from UniProt:P39180 | ||||
|
Δflu (Keio:JW1982) |
deletion |
deletion |
|||||
|
Δflu-768::kan |
| ||||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW1982 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAAACGACATCTGAATACCTG Primer 2:CCGAAGGTCACATTCAGTGTGGC | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 27% [8] | ||
|
zef-3129::Tn10 |
Linked marker |
est. P1 cotransduction: 62% [8] | |
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Caffrey, P & Owen, P (1989) Purification and N-terminal sequence of the alpha subunit of antigen 43, a unique protein complex associated with the outer membrane of Escherichia coli. J. Bacteriol. 171 3634-40 PubMed
- ↑ Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed
- ↑ 4.0 4.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 7.0 7.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 8.0 8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
