fhuC:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Standard Name |
fhuC |
---|---|
Gene Synonym(s) |
ECK0150, b0151, JW0147[1], JW0147 |
Product Desc. |
Component of iron (III) hydroxamate ABC transporter[2][3]; ferrichrome uptake system[3] Ferrichrome-dependent iron uptake, ABC transporter ATPase; associated with cytoplasmic membrane[4] |
Product Synonyms(s) |
iron-hydroxamate transporter subunit[1], ATP-binding component of ABC superfamily[1], B0151[2][1], FhuC[2][1] , ECK0150, JW0147, b0151 |
Function from GO |
<GO_nr /> |
Knock-Out Phenotype | |
Regulation/Expression | |
Regulation/Activity | |
Quick Links | |
edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
fhuC mutants are albomycin resistant.[4]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
fhuC |
---|---|
Mnemonic |
Ferric hydroxamate uptake |
Synonyms |
ECK0150, b0151, JW0147[1], JW0147 |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
3.66 minutes |
MG1655: 169778..170575 |
||
NC_012967: 172620..173417 |
||||
NC_012759: 169777..170574 |
||||
W3110 |
|
W3110: 169778..170575 |
||
DH10B: 143882..144679 |
||||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
fhuC(del) (Keio:JW0147) |
deletion |
deletion |
PMID:16738554 |
||||
fhuC::Tn5KAN-2 (FB20022) |
Insertion at nt 165 in Plus orientation |
PMID:15262929 |
does not contain pKD46 | ||||
fhuC7679(del)::kan |
PMID:16738554 |
| |||||
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW0147 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCCAGGAATACACGAATCATTC Primer 2:CCATAAACAAAACTCACAGGTGC | |
Kohara Phage |
PMID:3038334 | ||
Kohara Phage |
PMID:3038334 | ||
Linked marker |
est. P1 cotransduction: 46% [6] | ||
Linked marker |
est. P1 cotransduction: 4% [6] | ||
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10304 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10304 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000298 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EchoBASE:EB0300 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0000522 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
Standard name |
FhuC |
---|---|
Synonyms |
iron-hydroxamate transporter subunit[1], ATP-binding component of ABC superfamily[1], B0151[2][1], FhuC[2][1] , ECK0150, JW0147, b0151 |
Product description |
Component of iron (III) hydroxamate ABC transporter[2][3]; ferrichrome uptake system[3] Ferrichrome-dependent iron uptake, ABC transporter ATPase; associated with cytoplasmic membrane[4] |
EC number (for enzymes) |
|
edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
---|---|---|---|---|---|---|---|---|
GO:0000166 |
nucleotide binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR003593 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0000166 |
nucleotide binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0547 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005506 |
iron ion binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0408 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005524 |
ATP binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR003439 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005524 |
ATP binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR017871 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005524 |
ATP binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0067 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005886 |
plasma membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0997 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005886 |
plasma membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-1003 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006810 |
transport |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0813 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006811 |
ion transport |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0406 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006826 |
iron ion transport |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0410 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0015623 |
iron-chelate-transporting ATPase activity |
GOA:spec |
IEA: Inferred from Electronic Annotation |
EC:3.6.3.34 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016020 |
membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0472 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016787 |
hydrolase activity |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0378 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016887 |
ATPase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR003439 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016887 |
ATPase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR017871 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0017111 |
nucleoside-triphosphatase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR003593 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0019898 |
extrinsic to membrane |
GO_REF:0000023 |
IEA: Inferred from Electronic Annotation |
SP_SL:SL-9903 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
Partner Type | Partner | Notes | References | Evidence |
---|---|---|---|---|
Protein |
Subunits of iron (III) hydroxamate ABC transporter |
could be indirect |
||
Protein |
yjfP |
PMID:16606699 |
Experiment(s):EBI-1135723 | |
Protein |
Subunits of ferrichrome uptake system |
could be indirect |
| |
edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
Compartment | Description | Evidence | Reference/Source | Notes |
---|---|---|---|---|
cytoplasm |
From EcoCyc[3] |
| ||
edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
Name | |
---|---|
Sequence |
MQEYTNHSDT TFALRNISFR VPGRTLLHPL SLTFPAGKVT GLIGHNGSGK STLLKMLGRH QPPSEGEILL DAQPLESWSS KAFARKVAYL PQQLPPAEGM TVRELVAIGR YPWHGALGRF GAADREKVEE AISLVGLKPL AHRLVDSLSG GERQRAWIAM LVAQDSRCLL LDEPTSALDI AHQVDVLSLV HRLSQERGLT VIAVLHDINM AARYCDYLVA LRGGEMIAQG TPAEIMRGET LEMIYGIPMG ILPHPAGAAP VSFVY |
Length |
265 |
Mol. Wt |
28.886 kDa |
pI |
7.4 (calculated) |
Extinction coefficient |
26,930 - 27,180 (calc based on 7 Y, 3 W, and 2 C residues) |
edit table |
Domains/Motifs/Modification Sites
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
Resource type | Source | Notes/Reference |
---|---|---|
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
ASAP:ABE-0000522 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EcoCyc:EG10304 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10304 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
RegulonDB:ECK120000298 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0300 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
---|---|---|---|---|---|---|---|
Protein |
Ecoli K-12 |
11.085+/-0.146 |
Molecules/cell |
|
Single Molecule Fluorescence |
PMID:20671182 | |
mRNA |
Ecoli K-12 |
0.020702635 |
Molecules/cell |
|
by RNA_Seq |
PMID:20671182 | |
Protein |
E. coli K-12 MG1655 |
158 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
54 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
67a |
molecules/cell/generation |
|
Ribosome Profiling |
Low confidence in the sequencing data set. |
PMID: 24766808 |
edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
![]() Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:169758..169798
source=MG1655
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
Allele Name | Mutation | Phenotype | Reference |
---|---|---|---|
edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
Type | Reference | Notes |
---|---|---|
microarray |
NCBI GEO profiles for fhuC | |
microarray |
Summary of data for fhuC from multiple microarray studies | |
edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
Resource Name | Resource Type | Description | Source | Notes |
---|---|---|---|---|
GFP Fusion |
Intergenic region (169643..169856) fused to gfpmut2. |
GFP fusion described in Zaslaver, et al. | ||
edit table |
<protect></protect>
Notes
Accessions Related to fhuC Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10304 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0300 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10304 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000298 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0000522 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
Organism | Homologs (Statistics) | Comments |
---|---|---|
Xenopus tropicalis |
|
From Inparanoid:20070104 |
Shigella flexneri |
FHUC |
From SHIGELLACYC |
E. coli O157 |
FHUC |
From ECOO157CYC |
edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10304 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10304 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000298 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0300 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0000522 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 1.9 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 3.3 3.4 3.5 3.6 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed
Categories