fhuA:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
fhuA |
|---|---|
| Mnemonic |
Ferric hydroxamate uptake |
| Synonyms |
ECK0149, b0150, JW0146, T1, T5rec, tonA[1], tonA |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
3.61 minutes |
MG1655: 167484..169727 |
||
|
NC_012967: 170326..172569 |
||||
|
NC_012759: 167483..169726 |
||||
|
W3110 |
|
W3110: 167484..169727 |
||
|
DH10B: 141588..143831 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
167583 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
Strain DH10B |
W254X |
Nonsynonomous mutation |
This is a SNP in E. coli K-12 Strain DH10B | ||||
|
fhuA(del) (Keio:JW0146) |
deletion |
deletion |
|||||
|
fhuA(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Aspartate |
||||
|
fhuA23 |
|||||||
|
fhuA2 |
|||||||
|
fhuA21 |
|||||||
|
fhuA54 |
|||||||
|
fhuA27 |
|||||||
|
fhuA67 |
|||||||
|
fhuA48 |
|||||||
|
fhuA49 |
|||||||
|
fhuA1 |
|||||||
|
fhuA22 |
|||||||
|
fhuA24 |
|||||||
|
fhuA14 |
|||||||
|
fhuA31 |
|||||||
|
fhuA61 |
|||||||
|
fhuA16 |
|||||||
|
fhuA53 |
|||||||
|
fhuA13 |
|||||||
|
fhuA25 |
|||||||
|
fhuA66 |
|||||||
|
fhuA32 |
|||||||
|
fhuA58 |
|||||||
|
fhuA46 |
|||||||
|
fhuA57 |
|||||||
|
fhuA47 |
|||||||
|
fhuA55 |
|||||||
|
fhuA50 |
|||||||
|
fhuA51 |
|||||||
|
fhuA52 |
|||||||
|
fhuA12 |
|||||||
|
fhuA26 |
|||||||
|
fhuA0 |
|||||||
|
fhuA766(del)::kan |
|||||||
|
fhuA(del) |
Resistant to |
Resistant to phage T2. |
Experimental Strain:EKDr |
see figure 5 & 9 | |||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0146 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGCGCGTTCCAAAACTGCTCA Primer 2:CCGAAACGGAAGGTTGCGGTTGC | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 50% [10] | ||
|
Linked marker |
est. P1 cotransduction: 3% [10] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Coulton, JW et al. (1986) Protein fusions of beta-galactosidase to the ferrichrome-iron receptor of Escherichia coli K-12. J. Bacteriol. 165 181-92 PubMed
- ↑ Durfee, T et al. (2008) The complete genome sequence of Escherichia coli DH10B: insights into the biology of a laboratory workhorse. J. Bacteriol. 190 2597-606 PubMed
- ↑ 4.0 4.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ Ito, M et al. (2005) Functional analysis of 1440 Escherichia coli genes using the combination of knock-out library and phenotype microarrays. Metab. Eng. 7 318-27 PubMed
- ↑ Brochu, A et al. (1992) Modes of action and inhibitory activities of new siderophore-beta-lactam conjugates that use specific iron uptake pathways for entry into bacteria. Antimicrob. Agents Chemother. 36 2166-75 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 9.0 9.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 10.0 10.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
