fabI:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Standard Name |
fabI |
---|---|
Gene Synonym(s) | |
Product Desc. |
Enoyl-ACP reductase, NADH dependent[4] |
Product Synonyms(s) |
enoyl-[acyl-carrier-protein] reductase, NADH-dependent[1], B1288[2][1], Gts[2][1], QmeA[2][1], EnvM[2][1], FabI[2][1] , ECK1283, envM, gts, JW1281, qmeA, b1288 |
Function from GO |
<GO_nr /> |
Knock-Out Phenotype | |
Regulation/Expression | |
Regulation/Activity | |
Quick Links | |
edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
fabI is an essential gene. Binds TrxA (Kumar, 2004).[4]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
fabI |
---|---|
Mnemonic |
Fatty acid biosynthesis |
Synonyms | |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
29.06 minutes |
MG1655: 1349063..1348275 |
||
NC_012967: 1349408..1348620 |
||||
NC_012759: 1239124..1239912 |
||||
W3110 |
|
W3110: 1352753..1351965 |
||
DH10B: 1438459..1437671 |
||||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
Coding Start (SO:0000323) |
1348278 |
Edman degradation |
PMID:1364817 |
| |
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
fabIG93S |
G93S |
Diazaborine resistance |
seeded from UniProt:P0AEK4 | ||||
fabIS241F |
S241F |
Produces temperature-sensitive phenotype |
seeded from UniProt:P0AEK4 | ||||
fabI392(ts) |
C to T at position 1125 |
Ser to Phe at position 241 |
Growth Phenotype |
temperature sensitive |
PMID:4574419 |
originally named envM392 sequence of mutation[5] | |
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW1281 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCGGTTTTCTTTCCGGTAAGCG Primer 2:CCTTTCAGTTCGAGTTCGTTCAT | |
Kohara Phage |
PMID:3038334 | ||
Kohara Phage |
PMID:3038334 | ||
Linked marker |
est. P1 cotransduction: 30% [7] | ||
Linked marker |
est. P1 cotransduction: 47% [7] | ||
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG11528 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG11528 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120001482 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EchoBASE:EB1490 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0004327 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
Standard name |
FabI |
---|---|
Synonyms |
enoyl-[acyl-carrier-protein] reductase, NADH-dependent[1], B1288[2][1], Gts[2][1], QmeA[2][1], EnvM[2][1], FabI[2][1] , ECK1283, envM, gts, JW1281, qmeA, b1288 |
Product description |
Enoyl-ACP reductase, NADH dependent[4] |
EC number (for enzymes) | |
edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
---|---|---|---|---|---|---|---|---|
GO:0003824 |
catalytic activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR016040 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0004318 |
enoyl-(acyl-carrier-protein) reductase (NADH) activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR014358 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0004318 |
enoyl-(acyl-carrier-protein) reductase (NADH) activity |
GOA:spec |
IEA: Inferred from Electronic Annotation |
EC:1.3.1.9 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005886 |
plasma membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0997 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005886 |
plasma membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-1003 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006633 |
fatty acid biosynthetic process |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR014358 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006633 |
fatty acid biosynthetic process |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0275 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0008152 |
metabolic process |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR002198 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0008152 |
metabolic process |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR002347 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0008152 |
metabolic process |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR016040 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0008610 |
lipid biosynthetic process |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0444 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016020 |
membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0472 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016020 |
membrane |
PMID:16858726 |
IDA: Inferred from Direct Assay |
C |
Seeded from EcoCyc (v14.0) |
complete | ||
GO:0016491 |
oxidoreductase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR002198 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016491 |
oxidoreductase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR002347 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016491 |
oxidoreductase activity |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0560 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0019898 |
extrinsic to membrane |
GO_REF:0000023 |
IEA: Inferred from Electronic Annotation |
SP_SL:SL-9903 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0046677 |
response to antibiotic |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0046 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0055114 |
oxidation reduction |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR002347 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0055114 |
oxidation reduction |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR014358 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0055114 |
oxidation reduction |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0560 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
Partner Type | Partner | Notes | References | Evidence |
---|---|---|---|---|
Protein |
yfgI |
PMID:15690043 |
Experiment(s):EBI-887392 | |
Protein |
dnaN |
PMID:15690043 |
Experiment(s):EBI-887392 | |
Protein |
rho |
PMID:15690043 |
Experiment(s):EBI-887392 | |
Protein |
rplJ |
PMID:15690043 |
Experiment(s):EBI-887392 | |
Protein |
rpsA |
PMID:15690043 |
Experiment(s):EBI-887392 | |
Protein |
rpsJ |
PMID:15690043 |
Experiment(s):EBI-887392 | |
Protein |
ycbY |
PMID:15690043 |
Experiment(s):EBI-887392 | |
Protein |
yjgD |
PMID:15690043 |
Experiment(s):EBI-893265 | |
Protein |
rraB |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
dnaN |
PMID:19402753 |
MALDI(Z-score):36.876428 | |
Protein |
yfgI |
PMID:19402753 |
MALDI(Z-score):17.053160 | |
edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
Compartment | Description | Evidence | Reference/Source | Notes |
---|---|---|---|---|
edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
Name | |
---|---|
Sequence |
MGFLSGKRIL VTGVASKLSI AYGIAQAMHR EGAELAFTYQ NDKLKGRVEE FAAQLGSDIV LQCDVAEDAS IDTMFAELGK VWPKFDGFVH SIGFAPGDQL DGDYVNAVTR EGFKIAHDIS SYSFVAMAKA CRSMLNPGSA LLTLSYLGAE RAIPNYNVMG LAKASLEANV RYMANAMGPE GVRVNAISAG PIRTLAASGI KDFRKMLAHC EAVTPIRRTV TIEDVGNSAA FLCSDLSAGI SGEVVHVDGG FSIAAMNELE LK |
Length |
262 |
Mol. Wt |
27.864 kDa |
pI |
5.7 (calculated) |
Extinction coefficient |
15,930 - 16,430 (calc based on 7 Y, 1 W, and 4 C residues) |
edit table |
Domains/Motifs/Modification Sites
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
Resource type | Source | Notes/Reference |
---|---|---|
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
ASAP:ABE-0004327 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EcoCyc:EG11528 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG11528 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
RegulonDB:ECK120001482 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB1490 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
---|---|---|---|---|---|---|---|
Protein |
E. coli K-12 MC4100 |
1.25E+04 |
molecules/cell |
|
emPAI |
PMID:18304323 | |
Protein |
Ecoli K-12 |
342.234+/-1.677 |
Molecules/cell |
|
Single Molecule Fluorescence |
PMID:20671182 | |
mRNA |
Ecoli K-12 |
0.14852+/-0.01247 |
Molecules/cell |
|
by FISH |
PMID:20671182 | |
mRNA |
Ecoli K-12 |
0.293781726 |
Molecules/cell |
|
by RNA_Seq |
PMID:20671182 | |
Protein |
E. coli K-12 EMG2 |
240 |
molecules/cell |
|
Quantitative protein sequencing |
Spot ID: Ml02-2 |
PMID: 9298646 |
Protein |
E. coli K-12 MG1655 |
41315 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
8248 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
25585 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
![]() Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:1349043..1349083
source=MG1655
flip=1
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
Allele Name | Mutation | Phenotype | Reference |
---|---|---|---|
edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
Type | Reference | Notes |
---|---|---|
microarray |
NCBI GEO profiles for fabI | |
microarray |
Summary of data for fabI from multiple microarray studies | |
edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
Resource Name | Resource Type | Description | Source | Notes |
---|---|---|---|---|
edit table |
<protect></protect>
Notes
Accessions Related to fabI Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG11528 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB1490 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG11528 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120001482 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0004327 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
Organism | Homologs (Statistics) | Comments |
---|---|---|
Arabidopsis thaliana |
|
From Inparanoid:20070104 |
Oryza gramene |
|
From Inparanoid:20070104 |
Xenopus tropicalis |
|
From Inparanoid:20070104 |
Shigella flexneri |
FABI |
From SHIGELLACYC |
E. coli O157 |
FABI |
From ECOO157CYC |
edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG11528 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG11528 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120001482 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB1490 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0004327 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ Bergler, H et al. (1992) Sequences of the envM gene and of two mutated alleles in Escherichia coli. J. Gen. Microbiol. 138 2093-100 PubMed
- ↑ 6.0 6.1 CGSC: The Coli Genetics Stock Center
- ↑ 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
Categories