dnaX:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name | |
|---|---|
| Mnemonic | |
| Synonyms |
|
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
10.59 minutes |
MG1655: 491316..493247 |
||
|
NC_012967: 464159..466090 |
||||
|
NC_012759: 394075..396006 |
||||
|
W3110 |
|
W3110: 491316..493247 |
||
|
DH10B: 430647..432578 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
491319 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
dnaX36 |
E601K |
Growth Phenotype |
ts growth. Fast stop DNA replication arrest at 44° |
Affects Tau but not Gamma | |||
|
dnaX36 |
Weak mutator in mismatch repair deficient strain |
||||||
|
dnaX0 |
|||||||
|
dnaX2016 |
G118D |
Growth Phenotype |
Ts for replication and growth |
||||
|
dnaX36(ts) |
temperature sensitive |
||||||
|
dnaXE145A |
E145A |
failure to suppress parE10 when overexpressed |
|||||
|
dnaX(Ts) |
G118D |
Growth Phenotype |
temperature sensitive for replication and growth |
phenotype suppressed by mutations in DnaA | |||
| edit table |
<protect></protect>
Notes
The dnaX locus was identified by the J, Walker lab[6] as the site of one of several ts mutations in strain SG133, which was originally thought to contain a single mutation in dnaZ.[7]
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0459 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAGTTATCAGGTCTTAGCCCG Primer 2:CCAATGGGGCGGATACTTTCTTC | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 28% [11] | ||
|
Linked marker |
est. P1 cotransduction: 72% [11] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Maki, S & Kornberg, A (1988) DNA polymerase III holoenzyme of Escherichia coli. I. Purification and distinctive functions of subunits tau and gamma, the dnaZX gene products. J. Biol. Chem. 263 6547-54 PubMed
- ↑ 2.0 2.1 Pham, PT et al. (2006) Mutator mutants of Escherichia coli carrying a defect in the DNA polymerase III tau subunit. Mol. Microbiol. 59 1149-61 PubMed
- ↑ 3.0 3.1 Blinkova, A et al. (1993) The Escherichia coli DNA polymerase III holoenzyme contains both products of the dnaX gene, tau and gamma, but only tau is essential. J. Bacteriol. 175 6018-27 PubMed
- ↑ Espeli, O et al. (2003) Temporal regulation of topoisomerase IV activity in E. coli. Mol. Cell 11 189-201 PubMed
- ↑ Blinkova, A et al. (2003) Suppression of temperature-sensitive chromosome replication of an Escherichia coli dnaX(Ts) mutant by reduction of initiation efficiency. J. Bacteriol. 185 3583-95 PubMed
- ↑ Henson, JM et al. (1979) Isolation and characterization of dnaX and dnaY temperature-sensitive mutants of Escherichia coli. Genetics 92 1041-59 PubMed
- ↑ Sevastopoulos, CG et al. (1977) Large-scale automated isolation of Escherichia coli mutants with thermosensitive DNA replication. Proc. Natl. Acad. Sci. U.S.A. 74 3485-9 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 9.0 9.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 10.0 10.1 CGSC: The Coli Genetics Stock Center
- ↑ 11.0 11.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
