dnaA:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
dnaA |
|---|---|
| Mnemonic |
DNA |
| Synonyms |
ECK3694, b3702, JW3679[1], JW3679 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
83.63 minutes |
MG1655: 3881752..3880349 |
||
|
NC_012967: 3844090..3842687 |
||||
|
NC_012759: 3768682..3770085 |
||||
|
W3110 |
|
W3110: 3756686..3758089 |
||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
Strain DH10B |
P18S |
Nonsynonomous mutation |
This is a SNP in E. coli K-12 Strain DH10B | ||||
|
dnaA177(ts) |
temperature sensitive |
||||||
|
dnaA46 |
A184V and H252Y |
Growth Phenotype |
Temperature-sensitive for initiation of DNA replication. |
||||
|
dnaA508(ts) |
temperature sensitive |
||||||
|
dnaA5(ts) |
temperature sensitive |
||||||
|
dnaA46(ts) |
783 C->T (where +1 is the txn'l start site) |
Ala->Val |
Growth Phenotype |
temperature sensitive |
Sequence of the mutant allele is from Ohmori et al.[6] | ||
|
dnaAcos |
dnaA1(Cs) 699 A->T dnaA46(Ts) 783 C->T dnaA2(Cs) 986 C->T dnaA3(Cs) 1043 T->C (Where +1 is the txn'l start site) |
Gln->Leu Ala->Val His->Tyr Tyr->His |
Growth Phenotype |
over initiation of DNA replication at 30°C |
dnaAcos was isolated as a temperature-resistant revertant of dnaA46(Ts). [8] | ||
|
dnaA W6A |
W6A |
W6 is needed for oligomerization | |||||
|
dnaA311(Am) |
Growth Phenotype |
inhibition of initiation of DNA replication |
suppressed in supF, supE, supD, and supP strains | ||||
|
dnaA366(Am) |
Growth Phenotype |
inhibition of initiation of DNA replication |
| ||||
|
dnaA91(Am) |
Growth Phenotype |
inhibition of initiation of DNA replication |
suppressed in supF, supD, and supP strains | ||||
|
dnaA204(Ts) |
Resistant to |
blocks resistance to camphor in all mbr mutants |
|||||
|
dnaA167 |
Growth Phenotype |
temperature sensitive |
|||||
|
dnaA211 |
Growth Phenotype |
temperature sensitive |
|||||
|
dnaA606 |
Growth Phenotype |
temperature sensitive |
|||||
|
dnaA601 |
Growth Phenotype |
temperature sensitive |
|||||
|
dnaA604 |
Growth Phenotype |
temperature sensitive |
|||||
|
dnaA603 |
Growth Phenotype |
temperature sensitive |
|||||
|
dnaA205 |
Growth Phenotype |
temperature sensitive |
|||||
|
dnaA602 |
Growth Phenotype |
temperature sensitive |
|||||
|
dnaA203 |
Growth Phenotype |
temperature sensitive |
|||||
|
dnaA46 |
Resistant to |
Increased resistance to rifampin. |
Parent Strain: EC3 X EC6 Experimental Strain: EC8 |
Mutant phenotype found at Table 2. | |||
|
rpoB706 dnaA1 |
Growth Phenotype |
DnaA1 Mutant is unable to grow at 42.5C, mutation in rpoB suppresses thermosensitivity allowing the strain to grow at 42.5C. |
Experimental Strain: EC8 |
| |||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3679 |
Plasmid clone |
Status:Clone OK Primer 1:GCCTCACTTTCGCTTTGGCAGCA Primer 2:CCaGATGACAATGTTCTGATTAA | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
zid-501::Tn10 |
Linked marker |
est. P1 cotransduction: 81% [16] | |
|
Linked marker |
est. P1 cotransduction: 10% [16] | ||
|
tna::Tn10 |
Linked marker |
WP72[10] |
|
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Durfee, T et al. (2008) The complete genome sequence of Escherichia coli DH10B: insights into the biology of a laboratory workhorse. J. Bacteriol. 190 2597-606 PubMed
- ↑ Hansen, FG et al. (1992) Cloning and nucleotide sequence determination of twelve mutant dnaA genes of Escherichia coli. Mol. Gen. Genet. 234 14-21 PubMed
- ↑ 4.00 4.01 4.02 4.03 4.04 4.05 4.06 4.07 4.08 4.09 4.10 4.11 4.12 Hansen, EB et al. (1984) Fine structure genetic map and complementation analysis of mutations in the dnaA gene of Escherichia coli. Mol. Gen. Genet. 196 387-96 PubMed
- ↑ Zyskind, JW & Smith, DW (1977) NOVEL Escherichia coli dnaB mutant: direct involvement of the dnaB252 gene product in the synthesis of an origin-ribonucleic acid species during initiaion of a round of deoxyribonucleic acid replication. J. Bacteriol. 129 1476-86 PubMed
- ↑ Ohmori, H et al. (1984) Structural analysis of the dnaA and dnaN genes of Escherichia coli. Gene 28 159-70 PubMed
- ↑ Katayama, T et al. (1997) Overinitiation of chromosome replication in the Escherichia coli dnaAcos mutant depends on activation of oriC function by the dam gene product. Mol. Microbiol. 25 661-70 PubMed
- ↑ Kellenberger-Gujer, G et al. (1978) A cold sensitive dnaA mutant of E. coli which overinitiates chromosome replication at low temperature. Mol. Gen. Genet. 162 9-16 PubMed
- ↑ Felczak, MM et al. (2005) An essential tryptophan of Escherichia coli DnaA protein functions in oligomerization at the E. coli replication origin. J. Biol. Chem. 280 24627-33 PubMed
- ↑ 10.0 10.1 10.2 10.3 Schaus, N et al. (1981) Isolation and characterization of amber mutations in gene dnaA of escherichia coli K-12. J. Bacteriol. 145 904-13 PubMed
- ↑ Trun, NJ & Gottesman, S (1990) On the bacterial cell cycle: Escherichia coli mutants with altered ploidy. Genes Dev. 4 2036-47 PubMed
- ↑ 12.0 12.1 Bagdasarian, MM et al. (1977) Suppression of the DnaA phenotype by mutations in the rpoB cistron of ribonucleic acid polymerase in Salmonella typhimurium and Escherichia coli. J. Bacteriol. 130 577-82 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 14.0 14.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 15.0 15.1 CGSC: The Coli Genetics Stock Center
- ↑ 16.0 16.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
