dinB:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
dinB |
|---|---|
| Mnemonic |
damage inducible Damage inducible |
| Synonyms |
ECK0232, b0231, JW0221, dinP[1], dinP |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
5.41 minutes |
MG1655: 250898..251953 |
||
|
NC_012967: 255461..256516 |
||||
|
NC_012759: 250897..251952 |
||||
|
W3110 |
|
W3110: 250898..251953 |
||
|
DH10B: 225002..226057 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
dinB(del) (Keio:JW0221) |
deletion |
deletion |
|||||
|
dinP::Tn5KAN-I-SceI (FB20062) |
Insertion at nt 89 in Plus orientation |
does not contain pKD46 | |||||
|
dinP::Tn5KAN-I-SceI (FB20063) |
Insertion at nt 89 in Plus orientation |
contains pKD46 | |||||
|
dinBA310S |
A310S |
(in strain: ECOR 57B2, ECOR 59B2, ECOR 60B2 and ECOR 62B2) |
Strain variation; seeded from UniProt:Q47155 | ||||
|
dinBD321N |
D321N |
(in strain: ECOR 35D) |
Strain variation; seeded from UniProt:Q47155 | ||||
|
dinBD8A,H |
D8A,H |
Loss of function |
seeded from UniProt:Q47155 | ||||
|
dinBR49A,F |
R49A,F |
Loss of function |
seeded from UniProt:Q47155 | ||||
|
dinBD103A,N |
D103A,N |
Loss of function |
seeded from UniProt:Q47155 | ||||
|
dinBE104A |
E104A |
Loss of function |
seeded from UniProt:Q47155 | ||||
|
dinBM210I |
M210I |
(in strain: ECOR 37UG, ECOR 45B1, ECOR 51B2, ECOR 52B2, ECOR 58B1 and ECOR 70B1) |
Strain variation; seeded from UniProt:Q47155 | ||||
|
dinBM210T |
M210T |
(in strain: ECOR 35D, ECOR 46D, ECOR 49D, ECOR 50D, ECOR 57B2, ECOR 59B2, ECOR 60B2 and ECOR 62B2) |
Strain variation; seeded from UniProt:Q47155 | ||||
|
dinBR225C |
R225C |
(in strain: ECOR 59B2 and ECOR 60B2) |
Strain variation; seeded from UniProt:Q47155 | ||||
|
dinBERR36ARG |
ERR36ARG |
(in strain: ECOR 45B1) |
Strain variation; seeded from UniProt:Q47155 | ||||
|
dinBQ124K |
Q124K |
(in strain: ECOR 35D) |
Strain variation; seeded from UniProt:Q47155 | ||||
|
dinBN132S |
N132S |
(in strain: ECOR 34B1 and ECOR 37UG) |
Strain variation; seeded from UniProt:Q47155 | ||||
|
dinBQ135H |
Q135H |
(in strain: ECOR 70B1) |
Strain variation; seeded from UniProt:Q47155 | ||||
|
dinBP170S |
P170S |
(in strain: ECOR 37UG) |
Strain variation; seeded from UniProt:Q47155 | ||||
|
dinBA171T |
A171T |
(in strain: ECOR 45B1, ECOR 46D, ECOR 49D and ECOR 50D) |
Strain variation; seeded from UniProt:Q47155 | ||||
|
dinBL176F |
L176F |
(in strain: ECOR 37UG) |
Strain variation; seeded from UniProt:Q47155 | ||||
|
dinBG201S |
G201S |
(in strain: ECOR 59B2) |
Strain variation; seeded from UniProt:Q47155 | ||||
|
dinB10 |
xx |
PMID:| SMR |
we like this mutation a lot | ||||
|
F172A |
defective in UMuD interaction | ||||||
|
dinB749(del)::kan |
| ||||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0221 |
Plasmid clone |
Status:Clone OK Primer 1:GCCCGTAAAATCATTCATGTGGA Primer 2:CCTAATCCCAGCACCAGTTGTCT | |
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 50% [8] | ||
|
Linked marker |
est. P1 cotransduction: 74% [8] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 3.0 3.1 3.2 CGSC: The Coli Genetics Stock Center
- ↑ 4.0 4.1 Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ Godoy, VG et al. (2007) UmuD and RecA directly modulate the mutagenic potential of the Y family DNA polymerase DinB. Mol. Cell 28 1058-70 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 8.0 8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
