cysQ:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Standard Name |
cysQ |
---|---|
Gene Synonym(s) |
ECK4210, b4214, JW4172, amt, amtA[1], amtA |
Product Desc. |
affects pool of 3'-phosphoadenosine-5'-phosphosulfate in pathway of sulfite synthesis[2][3] 3'-phosphoadenosine 5'-phosphate (pAp) phosphatase; converts pAp to AMP; inhibited by lithium and calcium, leading to pAP accumulation; probable PAPS (adenosine 3'-phosphate 5'-phosphosulfate) 3'(2'),5'-bisphosphate nucleotidase: probably converts PAPS to[4] |
Product Synonyms(s) |
PAPS (adenosine 3'-phosphate 5'-phosphosulfate) 3'(2'),5'-bisphosphate nucleotidase[1], B4214[2][1], Amt[2][1], AmtA[2][1], CysQ[2][1] , amt, amtA, ECK4210, JW4172, b4214 |
Function from GO |
<GO_nr /> |
Knock-Out Phenotype | |
Regulation/Expression | |
Regulation/Activity | |
Quick Links | |
edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
CysQ is a main target of lithium toxicity in vivo. CysQ (AmtA) was originally thought to be involved in ammonium transport. CysQ may be part of a futile sulfur cycle with APS kinase CysC.[4]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
cysQ |
---|---|
Mnemonic |
Cysteine |
Synonyms |
ECK4210, b4214, JW4172, amt, amtA[1], amtA |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
95.58 minutes, 95.58 minutes |
MG1655: 4434778..4435518 |
||
NC_012967: 4421749..4422489 |
||||
NC_012759: 4373513..4374253 |
||||
W3110 |
|
W3110: 4441435..4442175 |
||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
Strain DH10B |
P68F |
Auxotrophies |
Nonsynonomous mutation |
PMID:18245285 |
This is a SNP in E. coli K-12 Strain DH10B | ||
ΔcysQ (Keio:JW4172) |
deletion |
deletion |
Auxotrophies |
PMID:16738554 |
|||
ΔcysQ763::kan |
deletion |
deletion |
Auxotrophies |
PMID:16738554 |
|||
cysQ::Tn5tac1 |
Growth Phenotype |
does not require cysteine for growth in anaerobic conditions, mutation is leaky but not revertible |
PMID:1729235 |
IPTG-induced transcription from Tn5tac1 turns off cysQ expression | |||
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW4172 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCTTAGATCAAGTATGCCAGCT Primer 2:CCGTAAATAGACACTCTGAACCC | |
Kohara Phage |
PMID:3038334 | ||
Kohara Phage |
PMID:3038334 | ||
Kohara Phage |
PMID:3038334 | ||
Linked marker |
est. P1 cotransduction: 75% [6] | ||
Linked marker |
est. P1 cotransduction: 71% [6] | ||
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10043 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10043 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000039 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EchoBASE:EB0041 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0013786 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
Standard name |
CysQ |
---|---|
Synonyms |
PAPS (adenosine 3'-phosphate 5'-phosphosulfate) 3'(2'),5'-bisphosphate nucleotidase[1], B4214[2][1], Amt[2][1], AmtA[2][1], CysQ[2][1] , amt, amtA, ECK4210, JW4172, b4214 |
Product description |
affects pool of 3'-phosphoadenosine-5'-phosphosulfate in pathway of sulfite synthesis[2][3] 3'-phosphoadenosine 5'-phosphate (pAp) phosphatase; converts pAp to AMP; inhibited by lithium and calcium, leading to pAP accumulation; probable PAPS (adenosine 3'-phosphate 5'-phosphosulfate) 3'(2'),5'-bisphosphate nucleotidase: probably converts PAPS to[4] |
EC number (for enzymes) |
|
edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
---|---|---|---|---|---|---|---|---|
GO:0000287 |
magnesium ion binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR006240 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0000287 |
magnesium ion binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0460 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0004437 |
inositol or phosphatidylinositol phosphatase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000760 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0004437 |
inositol or phosphatidylinositol phosphatase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR020550 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0004437 |
inositol or phosphatidylinositol phosphatase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR020583 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005737 |
cytoplasm |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0963 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005737 |
cytoplasm |
GO_REF:0000023 |
IEA: Inferred from Electronic Annotation |
SP_SL:SL-0086 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005886 |
plasma membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0997 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005886 |
plasma membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-1003 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0008441 |
3'(2'),5'-bisphosphate nucleotidase activity |
GOA:spec |
IEA: Inferred from Electronic Annotation |
EC:3.1.3.7 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005737 |
cytoplasm |
PMID:17616624 |
IC: Inferred by Curator |
C |
Missing: with/from | |||
GO:0016020 |
membrane |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR006240 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016020 |
membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0472 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
Partner Type | Partner | Notes | References | Evidence |
---|---|---|---|---|
edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
Compartment | Description | Evidence | Reference/Source | Notes |
---|---|---|---|---|
periplasm |
| |||
edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
Name | |
---|---|
Sequence |
MLDQVCQLAR NAGDAIMQVY DGTKPMDVVS KADNSPVTAA DIAAHTVIMD GLRTLTPDVP VLSEEDPPGW EVRQHWQRYW LVDPLDGTKE FIKRNGEFTV NIALIDHGKP ILGVVYAPVM NVMYSAAEGK AWKEECGVRK QIQVRDARPP LVVISRSHAD AELKEYLQQL GEHQTTSIGS SLKFCLVAEG QAQLYPRFGP TNIWDTAAGH AVAAAAGAHV HDWQGKPLDY TPRESFLNPG FRVSIY |
Length |
246 |
Mol. Wt |
27.174 kDa |
pI |
5.9 (calculated) |
Extinction coefficient |
44,920 - 45,295 (calc based on 8 Y, 6 W, and 3 C residues) |
edit table |
Domains/Motifs/Modification Sites
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
Resource type | Source | Notes/Reference |
---|---|---|
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
ASAP:ABE-0013786 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EcoCyc:EG10043 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10043 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
RegulonDB:ECK120000039 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0041 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
---|---|---|---|---|---|---|---|
Protein |
E. coli K-12 MC4100 |
2.12E+02 |
molecules/cell |
|
emPAI |
PMID:18304323 | |
Protein |
E. coli K-12 MG1655 |
902 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
533 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
667 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
![]() Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:4434758..4434798
source=MG1655
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
Allele Name | Mutation | Phenotype | Reference |
---|---|---|---|
edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
Type | Reference | Notes |
---|---|---|
microarray |
NCBI GEO profiles for cysQ | |
microarray |
Summary of data for cysQ from multiple microarray studies | |
edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
Resource Name | Resource Type | Description | Source | Notes |
---|---|---|---|---|
GFP Fusion |
Intergenic region (4434065..4434386) fused to gfpmut2. |
GFP fusion described in Zaslaver, et al. | ||
edit table |
<protect></protect>
Notes
Accessions Related to cysQ Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10043 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0041 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10043 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000039 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0013786 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
Organism | Homologs (Statistics) | Comments |
---|---|---|
Anopheles gambiae |
|
From Inparanoid:20070104 |
Caenorhabditis briggsae |
|
From Inparanoid:20070104 |
Caenorhabditis elegans |
|
From Inparanoid:20070104 |
Dictyostelium discoideum |
|
From Inparanoid:20070104 |
Drosophila melanogaster |
|
From Inparanoid:20070104 |
Drosophila pseudoobscura |
|
From Inparanoid:20070104 |
Oryza gramene |
|
From Inparanoid:20070104 |
Saccharomyces cerevisiae |
|
From Inparanoid:20070104 |
Schizosaccharomyces pombe |
|
From Inparanoid:20070104 |
Tetraodon nigroviridis |
|
From Inparanoid:20070104 |
Shigella flexneri |
CYSQ |
From SHIGELLACYC |
E. coli O157 |
CYSQ |
From ECOO157CYC |
edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10043 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10043 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000039 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0041 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0013786 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed
Categories
- Genes in OpenBioSystems with Promoter Fusions
- Genes with homologs in Anopheles gambiae
- Genes with homologs in Caenorhabditis briggsae
- Genes with homologs in Caenorhabditis elegans
- Genes with homologs in Dictyostelium discoideum
- Genes with homologs in Drosophila melanogaster
- Genes with homologs in Drosophila pseudoobscura
- Genes with homologs in Oryza gramene
- Genes with homologs in Saccharomyces cerevisiae
- Genes with homologs in Schizosaccharomyces pombe
- Genes with homologs in Tetraodon nigroviridis
- Genes with homologs in Shigella flexneri
- Genes with homologs in E. coli O157