{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	csrA
Gene Synonym(s)	ECK2691, b2696, JW2666, zfiA^[1], zfiA
Product Desc.	carbon storage regulator; controls glycogen synthesis, gluconeogenesis, cell size and surface properties^[2]^[3]; Component of CsrA complex with CsrB RNA^[3] Global regulator of carbon source metabolism; CsrA exerts reciprocal effects on glycolysis versus gluconeogenesis and glycogen biosynthesis; glgC mRNA-binding activity blocks GlgC translation; csrB RNA inhibits csrA^[4]
Product Synonyms(s)	pleiotropic regulatory protein for carbon source metabolism^[1], B2696^[2]^[1], ZfiA^[2]^[1], CsrA^[2]^[1] , ECK2691, JW2666, zfiA, b2696
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): csrA^[2]
Regulation/Activity
Quick Links
edit table

See Help:Quickview for help with entering information in the Quickview table.

Notes

[back to top]

Recombinant CsrA-His6 was N-terminally sequenced, but this does not Verify since translation start was forced at ATG: Met is not clipped: MLIL start. CsrA also postively regulates FlhCD post-translationally, and hence is required for motility.^[4]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	csrA
Mnemonic	Carbon storage regulator
Synonyms	ECK2691, b2696, JW2666, zfiA^[1], zfiA
edit table

Notes

Location(s) and DNA Sequence

[back to top]

See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	60.72 minutes	MG1655: 2817168..2816983 <gbrowseImage> name=NC_000913:2816983..2817168 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 2714005..2713820 <gbrowseImage> name=NC_012967:2713820..2714005 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 2702795..2702980 <gbrowseImage> name=NC_012759:2702795..2702980 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 2817802..2817617 <gbrowseImage> name=NC_007779:2817617..2817802 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 2909710..2909525 <gbrowseImage> name=NC_010473:2909525..2909710 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Type	Phenotype: Description	Reference	Availability	Comments
csrA905						CGSC:72207
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW2666	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCCTGATTCTGACTCGTCGAGT Primer 2:CCGTAACTGGACTGCTGGGATTT
23B7	Kohara Phage	Genobase	PMID:3038334
pheA18::Tn10	Linked marker	CAG12158 = CGSC7421^[5]	est. P1 cotransduction: % ^[6]
srlD3131::Tn10	Linked marker	CAG18642 = CGSC7423^[5]	est. P1 cotransduction: 75% ^[6] Synonyms:zfh-3131::Tn10, zfi-3131::Tn10
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG11447	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG11447	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001410	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:947176	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1416	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0008866	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	CsrA
Synonyms	pleiotropic regulatory protein for carbon source metabolism^[1], B2696^[2]^[1], ZfiA^[2]^[1], CsrA^[2]^[1] , ECK2691, JW2666, zfiA, b2696
Product description	carbon storage regulator; controls glycogen synthesis, gluconeogenesis, cell size and surface properties^[2]^[3]; Component of CsrA complex with CsrB RNA^[3] Global regulator of carbon source metabolism; CsrA exerts reciprocal effects on glycolysis versus gluconeogenesis and glycogen biosynthesis; glgC mRNA-binding activity blocks GlgC translation; csrB RNA inhibits csrA^[4]
EC number (for enzymes)
edit table

Notes

Function

[back to top]

Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0003723	RNA binding	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_00167	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003723	RNA binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR003751	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003723	RNA binding	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0694	F	Seeded from EcoCyc (v14.0)	complete
	GO:0006109	regulation of carbohydrate metabolic process	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_00167	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006109	regulation of carbohydrate metabolic process	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR003751	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006402	mRNA catabolic process	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_00167	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006402	mRNA catabolic process	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR003751	P	Seeded from EcoCyc (v14.0)	complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	Notes	References	Evidence
Protein	Subunits of CsrA complex with CsrB RNA	could be indirect
Protein	dnaN		PMID:19402753^[7]	LCMS(ID Probability):99.6 MALDI(Z-score):35.462038
Protein	rpmC		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	eno		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	rplE		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	rplR		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	rpmB		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	tig		PMID:19402753^[7]	LCMS(ID Probability):99.6 MALDI(Z-score):39.245483
Protein	rpsN		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	rplT		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	rplO		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	rho		PMID:19402753^[7]	LCMS(ID Probability):99.6 MALDI(Z-score):39.045828
Protein	hupA		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	hupB		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	rpsA		PMID:19402753^[7]	LCMS(ID Probability):99.6 MALDI(Z-score):23.860281
Protein	rpsI		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	rplF		PMID:19402753^[7]	LCMS(ID Probability):99.6 MALDI(Z-score):4.332004
Protein	rpsP		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	rplI		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	dnaJ		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	rplQ		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	rpsF		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	rpsS		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	rplS		PMID:19402753^[7]	LCMS(ID Probability):99.6 MALDI(Z-score):5.648246
Protein	rplU		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	rpsM		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	rplX		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	rplM		PMID:19402753^[7]	LCMS(ID Probability):99.6 MALDI(Z-score):22.179834
Protein	nagC		PMID:19402753^[7]	LCMS(ID Probability):99.6 MALDI(Z-score):10.961368
Protein	rplA		PMID:19402753^[7]	LCMS(ID Probability):99.6 MALDI(Z-score):18.527392
Protein	rpsC		PMID:19402753^[7]	LCMS(ID Probability):99.6 MALDI(Z-score):30.548305
Protein	rpsD		PMID:19402753^[7]	LCMS(ID Probability):99.6 MALDI(Z-score):31.398357
Protein	rlmL		PMID:19402753^[7]	MALDI(Z-score):25.017977
Protein	skp		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	lpxD		PMID:19402753^[7]	LCMS(ID Probability):99.3 MALDI(Z-score):5.587843
Protein	rpoA		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	rplD		PMID:19402753^[7]	LCMS(ID Probability):99.6 MALDI(Z-score):10.391520
Protein	infC		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	rne		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	rnr		PMID:19402753^[7]	LCMS(ID Probability):99.3 MALDI(Z-score):26.968435
Protein	yfiF		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	rhlB		PMID:19402753^[7]	LCMS(ID Probability):99.6
Protein	deaD		PMID:19402753^[7]	LCMS(ID Probability):99.6 MALDI(Z-score):28.305076
Protein	rluB		PMID:19402753^[7]	MALDI(Z-score):36.330881
edit table

Notes

CsrA-his6 binding recovers mRNA from ~700 genes. CarB and CsrC RNAs titrate out CsrA and compete with mRNA targets.

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source	Notes
edit table

Notes

Structure and Physical Properties

[back to top]

Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MLILTRRVGE TLMIGDEVTV TVLGVKGNQV RIGVNAPKEV SVHREEIYQR IQAEKSQQSS Y
Length	61
Mol. Wt	6.855 kDa
pI	9.6 (calculated)
Extinction coefficient	2,980 (calc based on 2 Y, 0 W, and 0 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
Domain	1..54	PF02599 Global regulator protein family		PMID:19920124^[8]
edit table

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=csrA taxon=562,83333 </beststructure>

Models

View models at:

edit table

Structure figures

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16130603	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:947176	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0008866	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P69913	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:EG11447	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG11447	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:947176	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001410	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1416	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

CsrA is indirectly auto regulated.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Notes	Reference(s)
Protein	E. coli K-12 MC4100	3.12E+04	molecules/cell	Medium: median data from rich and minimal media Temperature (°C): 37 Doubling time (min): Growth Rate(min): Growth phase: other:	emPAI		PMID:18304323
Protein	Ecoli K-12	473.979+/-3.242	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		Single Molecule Fluorescence	PMID:20671182
mRNA	Ecoli K-12	0.94454+/-0.02241	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		by FISH	PMID:20671182
mRNA	Ecoli K-12	2.564864865	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		by RNA_Seq	PMID:20671182
Protein	E. coli K-12 MG1655	18982	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	7647	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	16543	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
csrA
edit table

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<gbrowseImage> name=NC_000913:2817148..2817188 source=MG1655 flip=1 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b2696 (EcoliWiki Page)	NCBI GEO profiles for csrA
microarray	GenExpDB:b2696 (EcoliWiki Page)	Summary of data for csrA from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
edit table

Notes

Accessions Related to csrA Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG11447	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1416	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b2696
EcoGene	EcoGene:EG11447	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001410	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0008866	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Shigella flexneri	CSRA	From SHIGELLACYC
E. coli O157	CSRA	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Pfam (EcoliWiki Page)	PF02599 Global regulator protein family
Superfamily (EcoliWiki Page)	SUPERFAMILY:117130
EcoCyc	EcoCyc:EG11447	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG11447	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001410	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1416	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0008866	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.00 ^1.01 ^1.02 ^1.03 ^1.04 ^1.05 ^1.06 ^1.07 ^1.08 ^1.09 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.0 ^2.1 ^2.2 ^2.3 ^2.4 ^2.5 ^2.6 ^2.7 ^2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.0 ^3.1 ^3.2 ^3.3 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 ^4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ ^5.0 ^5.1 CGSC: The Coli Genetics Stock Center
↑ ^6.0 ^6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
↑ ^7.00 ^7.01 ^7.02 ^7.03 ^7.04 ^7.05 ^7.06 ^7.07 ^7.08 ^7.09 ^7.10 ^7.11 ^7.12 ^7.13 ^7.14 ^7.15 ^7.16 ^7.17 ^7.18 ^7.19 ^7.20 ^7.21 ^7.22 ^7.23 ^7.24 ^7.25 ^7.26 ^7.27 ^7.28 ^7.29 ^7.30 ^7.31 ^7.32 ^7.33 ^7.34 ^7.35 ^7.36 ^7.37 ^7.38 ^7.39 ^7.40 ^7.41 ^7.42 Hu, P et al. (2009) Global functional atlas of Escherichia coli encompassing previously uncharacterized proteins. PLoS Biol. 7 e96 PubMed
↑ Finn, RD et al. (2010) The Pfam protein families database. Nucleic Acids Res. 38 D211-22 PubMed

csrA:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to csrA Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search