coaE:On One Page

From EcoliWiki
Jump to: navigation, search

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Quickview | Gene | Product(s) | Expression| Evolution | References |

Quickview

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

<protect>

Standard Name

coaE

Gene Synonym(s)

ECK0103, b0103, JW0100, yacE[1], yacE

Product Desc.

EG12312[2][3]

Dephospho-CoA kinase; final step in CoA synthesis[4]

Product Synonyms(s)

dephospho-CoA kinase[1], B0103[2][1], YacE[2][1], CoaE[2][1] , ECK0103, JW0100, yacE, b0103

Function from GO

<GO_nr />

Knock-Out Phenotype
Regulation/Expression

transcription unit(s): yacG[2]

Regulation/Activity
Quick Links

porteco.png EcoCyc.gif regulondb.jpg

dnadisplay.png proteindisplay.png   pubmed.jpg   textpresso.jpg  

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]


coaE is essential for growth as tested by genetic footprinting. The N-terminus of a recombinant protein was sequenced, as noted in SWISS-PROT, but this is not Verification since plasmid gene expression was forced at this ATG. in addition, an Ala was added during cloning between the fMet and the penultimate Arg residue.[4]



Gene

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

coaE

Mnemonic

Coenzyme A

Synonyms

ECK0103, b0103, JW0100, yacE[1], yacE

</protect>

Notes

Location(s) and DNA Sequence

[back to top]


<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

2.43 minutes 

MG1655: 113219..112599
<gbrowseImage> name=NC_000913:112599..113219 source=MG1655 preset=GeneLocation </gbrowseImage>

REL606

NC_012967: 116023..115403
<gbrowseImage> name=NC_012967:115403..116023 source=REL606 preset=GeneLocation </gbrowseImage>

BW2952

NC_012759: 112598..113218
<gbrowseImage> name=NC_012759:112598..113218 source=BW2952 preset=GeneLocation </gbrowseImage>

W3110

 

W3110: 113219..112599
<gbrowseImage> name=NC_007779:112599..113219 source=W3110 preset=GeneLocation </gbrowseImage>

DH10B

DH10B: 87323..86703
<gbrowseImage> name=NC_010473:86703..87323 source=DH10B preset=GeneLocation </gbrowseImage>

</protect>

Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

<protect></protect>

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

coaE(del) (Keio:JW0100)

deletion

deletion

PMID:16738554

Shigen

Strain contains duplication detected by PCR PMID:18652654

yacE(del)::kan

deletion

Biolog:respiration

unable to respire Acetate

PMID:16095938

yacE(del)::kan

deletion

Biolog:respiration

unable to respire a-Ketobutyrate

PMID:16095938

yacE(del)::kan

deletion

Biolog:respiration

unable to respire a-Ketoglutarate

PMID:16095938

yacE(del)::kan

deletion

Biolog:respiration

unable to respire Succinate

PMID:16095938

yacE(del)::kan

deletion

Biolog:respiration

unable to respire Bromosuccinate

PMID:16095938

yacE(del)::kan

deletion

Biolog:respiration

unable to respire L-Alanine

PMID:16095938

yacE(del)::kan

deletion

Biolog:respiration

unable to respire L-Asparagine

PMID:16095938

yacE(del)::kan

deletion

Biolog:respiration

unable to respire L-Aspartate

PMID:16095938

yacE(del)::kan

deletion

Biolog:respiration

unable to respire L-Serine

PMID:16095938

coaE722(del)::kan

PMID:16738554

CGSC:100358

This allele appears to not exist in the Keio collection. PCR analysis indicates an intact coaE gene in both JW0100 Keio strains.

<protect></protect>

Notes

The Keio collection[5] lists a deletion of coaE. The insertion in this strain is a duplication of the coaE region.[6]


Genetic Interactions

[back to top]


<protect>

Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

</protect>

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW0100

Plasmid clone

Shigen

PMID:16769691

Status:Clone OK

Primer 1:GCCAGGTATATAGTTGCCTTAAC

Primer 2:CCCGGTTTTTCCTGTGAGACAAA

15B8

Kohara Phage

Genobase

PMID:3038334

leuO3051::Tn10

Linked marker

CAG12095 = CGSC7324[7]

est. P1 cotransduction: 32% [8]
Synonyms:zab-3051::Tn10 nnnThe start of leuO was reannotated by Riley et al. (2006).

zad-220::Tn10

Linked marker

CAG12025 = CGSC7326[7]

est. P1 cotransduction: 23% [8]

<protect></protect>

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG12312

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG12312

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120002189

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:949060

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB2218

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0000357

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



Product(s)

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name

CoaE

Synonyms

dephospho-CoA kinase[1], B0103[2][1], YacE[2][1], CoaE[2][1] , ECK0103, JW0100, yacE, b0103

Product description

EG12312[2][3]

Dephospho-CoA kinase; final step in CoA synthesis[4]

EC number (for enzymes)

<protect></protect>

Notes

yacE is reported to encode dephospho-CoA kinase, which catalyzes the final step of Coenzyme A anabolism.[9]

Function

[back to top]


<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier GO ID GO term name Reference Evidence Code with/from Aspect Notes Status

GO:0030288

outer membrane-bounded periplasmic space

C

Seeded from Riley et al 2006 [1].

Missing: evidence, reference

GO:0000166

nucleotide binding

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0547

F

Seeded from EcoCyc (v14.0)

complete

GO:0004140

dephospho-CoA kinase activity

GOA:hamap
GO_REF:0000020

IEA: Inferred from Electronic Annotation

HAMAP:MF_00376

F

Seeded from EcoCyc (v14.0)

complete

GO:0004140

dephospho-CoA kinase activity

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR001977

F

Seeded from EcoCyc (v14.0)

complete

GO:0004140

dephospho-CoA kinase activity

GOA:spec
GO_REF:0000003

IEA: Inferred from Electronic Annotation

EC:2.7.1.24

F

Seeded from EcoCyc (v14.0)

complete

GO:0005524

ATP binding

GOA:hamap
GO_REF:0000020

IEA: Inferred from Electronic Annotation

HAMAP:MF_00376

F

Seeded from EcoCyc (v14.0)

complete

GO:0005524

ATP binding

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR001977

F

Seeded from EcoCyc (v14.0)

complete

GO:0005524

ATP binding

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0067

F

Seeded from EcoCyc (v14.0)

complete

GO:0005737

cytoplasm

GOA:hamap
GO_REF:0000020

IEA: Inferred from Electronic Annotation

HAMAP:MF_00376

C

Seeded from EcoCyc (v14.0)

complete

GO:0005737

cytoplasm

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0963

C

Seeded from EcoCyc (v14.0)

complete

GO:0005737

cytoplasm

GO_REF:0000023

IEA: Inferred from Electronic Annotation

SP_SL:SL-0086

C

Seeded from EcoCyc (v14.0)

complete

GO:0015937

coenzyme A biosynthetic process

GOA:hamap
GO_REF:0000020

IEA: Inferred from Electronic Annotation

HAMAP:MF_00376

P

Seeded from EcoCyc (v14.0)

complete

GO:0015937

coenzyme A biosynthetic process

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR001977

P

Seeded from EcoCyc (v14.0)

complete

GO:0015937

coenzyme A biosynthetic process

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0173

P

Seeded from EcoCyc (v14.0)

complete

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type Partner Notes References Evidence

Protein

dps

PMID:19402753

LCMS(ID Probability):99.6

Protein

speD

PMID:19402753

LCMS(ID Probability):99.6

</protect>

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment Description Evidence Reference/Source Notes

<protect></protect>

Notes

Structure and Physical Properties

[back to top]


<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence

at EcoCyc

MRYIVALTGG IGSGKSTVAN AFADLGINVI DADIIARQVV EPGAPALHAI ADHFGANMIA
ADGTLQRRAL RERIFANPEE KNWLNALLHP LIQQETQHQI QQATSPYVLW VVPLLVENSL
YKKANRVLVV DVSPETQLKR TMQRDDVTRE HVEQILAAQA TREARLAVAD DVIDNNGAPD
AIASDVARLH AHYLQLASQF VSQEKP
Length

206

Mol. Wt

22.621 kDa

pI

6.2 (calculated)

Extinction coefficient

16,960 (calc based on 4 Y, 2 W, and 0 C residues)


Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type Residues Description Notes References

Domain

3..181

PF01121 Dephospho-CoA kinase

PMID:19920124

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=coaE taxon=562,83333 </beststructure>

Models

View models at:

</protect>

Structure figures

<protect>

</protect>

Notes

Gene Product Resources

[back to top]


See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type Source Notes/Reference

<protect></protect>

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

NCBI (Protein) (EcoliWiki Page)

GI:16128096

Escherichia coli str. K-12 substr. MG1655

NCBI (Protein) (EcoliWiki Page)

GeneID:949060

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0000357

Escherichia coli str. K-12 substr. MG1655

UniProt (EcoliWiki Page)

UniProtKB/Swiss-Prot:P0A6I9

Escherichia coli str. K-12 substr. MG1655

EcoCyc

EcoCyc:EG12312

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG12312

Escherichia coli str. K-12 substr. MG1655

NCBI (Gene) (EcoliWiki Page)

GeneID:949060

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120002189

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB2218

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]




Expression

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.


Cellular Levels

[back to top]


See Help:Cellular levels

Molecule Organism or Strain Value Units Experimental Conditions Assay used Notes Reference(s)

Protein

E. coli K-12 MG1655

283

molecules/cell/generation

  • Medium: MOPS Complete
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

133

molecules/cell/generation

  • Medium: MOPS Minimal
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

141

molecules/cell/generation

  • Medium: MOPS Complete without Methionine
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Notes

Transcription and Transcriptional Regulation

[back to top]


<protect>

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)

yacG

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]


<protect><gbrowseImage> name=NC_000913:113199..113239 source=MG1655 flip=1 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]


<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name Mutation Phenotype Reference


Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type Reference Notes

microarray

GEO Profiles:b0103 (EcoliWiki Page)

NCBI GEO profiles for coaE

microarray

GenExpDB:b0103 (EcoliWiki Page)

Summary of data for coaE from multiple microarray studies


Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name Resource Type Description Source Notes

GFP Fusion

Intergenic region (113151..113517) fused to gfpmut2.

OpenBioSystems

GFP fusion described in Zaslaver, et al.
Plate:109-AZ06; Well:A1[10]

<protect></protect>

Notes

Accessions Related to coaE Expression

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG12312

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB2218

Escherichia coli str. K-12 substr. MG1655

EcoliGenExpDB (EcoliWiki Page)

EcoliGenExpDB:b0103

EcoGene

EcoGene:EG12312

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120002189

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0000357

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



Evolution

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]


See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism Homologs (Statistics) Comments

Anopheles gambiae

  • ENSANGP00000017632 (score: 1.000; bootstrap: 87%)

From Inparanoid:20070104

Apis mellifera

  • ENSAPMP00000025726 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Arabidopsis thaliana

  • AT2G27490 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Bos taurus

  • ENSBTAP00000007945 (score: 1.000; bootstrap: 94%)

From Inparanoid:20070104

Caenorhabditis briggsae

  • WBGene00031493 (score: 1.000; bootstrap: 86%)

From Inparanoid:20070104

Caenorhabditis elegans

  • WBGene00011500 (score: 1.000; bootstrap: 90%)

From Inparanoid:20070104

Canis familiaris

  • ENSCAFP00000022023 (score: 1.000; bootstrap: 100%)
  • ENSCAFP00000020537 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Ciona intestinalis

  • ENSCINP00000015584 (score: 1.000; bootstrap: 92%)

From Inparanoid:20070104

Danio rerio

  • ZDB-GENE-040912-137 (score: 1.000; bootstrap: 100%)
  • ZDB-CDNA-040912-139 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Dictyostelium discoideum

  • DDB0231517 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Drosophila melanogaster

  • FBgn0037469 (score: 1.000; bootstrap: 74%)

From Inparanoid:20070104

Drosophila pseudoobscura

  • GA15141-PA (score: 1.000; bootstrap: 65%)

From Inparanoid:20070104

Gallus gallus

  • ENSGALP00000001281 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Homo sapiens

  • ENSP00000341504 (score: 1.000; bootstrap: 95%)

From Inparanoid:20070104

Macaca mulatta

  • ENSMMUP00000005435 (score: 1.000; bootstrap: 83%)

From Inparanoid:20070104

Monodelphis domestica

  • ENSMODP00000014067 (score: 1.000; bootstrap: 98%)

From Inparanoid:20070104

Mus musculus

  • MGI:1915337 (score: 1.000; bootstrap: 95%)

From Inparanoid:20070104

Pan troglodytes

  • ENSPTRP00000046355 (score: 1.000; bootstrap: 72%)

From Inparanoid:20070104

Rattus norvegicus

  • ENSRNOP00000037891 (score: 1.000; bootstrap: 96%)

From Inparanoid:20070104

Saccharomyces cerevisiae

  • YDR196C (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Schizosaccharomyces pombe

  • SPCC14G101 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Takifugu rubripes

  • NEWSINFRUP00000164207 (score: 1.000; bootstrap: 99%)

From Inparanoid:20070104

Tetraodon nigroviridis

  • GSTENP00019537001 (score: 1.000; bootstrap: 100%)
  • GSTENP00008650001 (score: 0.425)

From Inparanoid:20070104

Xenopus tropicalis

  • ENSXETP00000006917 (score: 1.000; bootstrap: 93%)

From Inparanoid:20070104

Shigella flexneri

YACE

From SHIGELLACYC

E. coli O157

YACE

From ECOO157CYC


Do-It-Yourself Web Tools

<protect></protect>

Notes

Families

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

Pfam (EcoliWiki Page)

PF01121 Dephospho-CoA kinase

Superfamily (EcoliWiki Page)

SUPERFAMILY:52540

Panther (EcoliWiki Page)

PTHR10695:SF11

EcoCyc

EcoCyc:EG12312

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG12312

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120002189

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB2218

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0000357

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  3. 3.0 3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  4. 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
  5. Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
  6. Yamamoto, N et al. (2009) Update on the Keio collection of Escherichia coli single-gene deletion mutants. Mol. Syst. Biol. 5 335 PubMed
  7. 7.0 7.1 CGSC: The Coli Genetics Stock Center
  8. 8.0 8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
  9. Mishra, P et al. (2001) Identification of yacE (coaE) as the structural gene for dephosphocoenzyme A kinase in Escherichia coli K-12. J. Bacteriol. 183 2774-8 PubMed
  10. Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed

Categories

[back to top]