{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	coaE
Gene Synonym(s)	ECK0103, b0103, JW0100, yacE^[1], yacE
Product Desc.	EG12312^[2]^[3] Dephospho-CoA kinase; final step in CoA synthesis^[4]
Product Synonyms(s)	dephospho-CoA kinase^[1], B0103^[2]^[1], YacE^[2]^[1], CoaE^[2]^[1] , ECK0103, JW0100, yacE, b0103
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): yacG^[2]
Regulation/Activity
Quick Links
edit table

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]

coaE is essential for growth as tested by genetic footprinting. The N-terminus of a recombinant protein was sequenced, as noted in SWISS-PROT, but this is not Verification since plasmid gene expression was forced at this ATG. in addition, an Ala was added during cloning between the fMet and the penultimate Arg residue.^[4]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	coaE
Mnemonic	Coenzyme A
Synonyms	ECK0103, b0103, JW0100, yacE^[1], yacE
edit table

</protect>

Notes

Location(s) and DNA Sequence

[back to top]

<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	2.43 minutes	MG1655: 113219..112599 <gbrowseImage> name=NC_000913:112599..113219 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 116023..115403 <gbrowseImage> name=NC_012967:115403..116023 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 112598..113218 <gbrowseImage> name=NC_012759:112598..113218 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 113219..112599 <gbrowseImage> name=NC_007779:112599..113219 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 87323..86703 <gbrowseImage> name=NC_010473:86703..87323 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

</protect>

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Type	Phenotype: Description	Reference	Availability	Comments
coaE(del) (Keio:JW0100)	deletion	deletion			PMID:16738554	Shigen	Strain contains duplication detected by PCR PMID:18652654
yacE(del)::kan	deletion		Biolog:respiration	unable to respire Acetate	PMID:16095938
yacE(del)::kan	deletion		Biolog:respiration	unable to respire a-Ketobutyrate	PMID:16095938
yacE(del)::kan	deletion		Biolog:respiration	unable to respire a-Ketoglutarate	PMID:16095938
yacE(del)::kan	deletion		Biolog:respiration	unable to respire Succinate	PMID:16095938
yacE(del)::kan	deletion		Biolog:respiration	unable to respire Bromosuccinate	PMID:16095938
yacE(del)::kan	deletion		Biolog:respiration	unable to respire L-Alanine	PMID:16095938
yacE(del)::kan	deletion		Biolog:respiration	unable to respire L-Asparagine	PMID:16095938
yacE(del)::kan	deletion		Biolog:respiration	unable to respire L-Aspartate	PMID:16095938
yacE(del)::kan	deletion		Biolog:respiration	unable to respire L-Serine	PMID:16095938
coaE722(del)::kan					PMID:16738554	CGSC:100358	This allele appears to not exist in the Keio collection. PCR analysis indicates an intact coaE gene in both JW0100 Keio strains.
edit table

Notes

The Keio collection^[5] lists a deletion of coaE. The insertion in this strain is a duplication of the coaE region.^[6]

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

</protect>

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW0100	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCAGGTATATAGTTGCCTTAAC Primer 2:CCCGGTTTTTCCTGTGAGACAAA
15B8	Kohara Phage	Genobase	PMID:3038334
leuO3051::Tn10	Linked marker	CAG12095 = CGSC7324^[7]	est. P1 cotransduction: 32% ^[8] Synonyms:zab-3051::Tn10 nnnThe start of leuO was reannotated by Riley et al. (2006).
zad-220::Tn10	Linked marker	CAG12025 = CGSC7326^[7]	est. P1 cotransduction: 23% ^[8]
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG12312	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG12312	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120002189	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:949060	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB2218	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0000357	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	CoaE
Synonyms	dephospho-CoA kinase^[1], B0103^[2]^[1], YacE^[2]^[1], CoaE^[2]^[1] , ECK0103, JW0100, yacE, b0103
Product description	EG12312^[2]^[3] Dephospho-CoA kinase; final step in CoA synthesis^[4]
EC number (for enzymes)	2.7.1.24^[1]
edit table

Notes

yacE is reported to encode dephospho-CoA kinase, which catalyzes the final step of Coenzyme A anabolism.^[9]

Function

[back to top]

<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0030288	outer membrane-bounded periplasmic space				C	Seeded from Riley et al 2006 ^[1].	Missing: evidence, reference
	GO:0000166	nucleotide binding	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0547	F	Seeded from EcoCyc (v14.0)	complete
	GO:0005524	ATP binding	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_00376	F	Seeded from EcoCyc (v14.0)	complete
	GO:0005524	ATP binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR001977	F	Seeded from EcoCyc (v14.0)	complete
	GO:0005524	ATP binding	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0067	F	Seeded from EcoCyc (v14.0)	complete
	GO:0015937	coenzyme A biosynthetic process	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_00376	P	Seeded from EcoCyc (v14.0)	complete
	GO:0015937	coenzyme A biosynthetic process	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR001977	P	Seeded from EcoCyc (v14.0)	complete
	GO:0015937	coenzyme A biosynthetic process	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0173	P	Seeded from EcoCyc (v14.0)	complete
	GO:0004140	dephospho-CoA kinase activity	PMID:12538896	ISS: Inferred from Sequence or Structural Similarity	UniProtKB:P44920	F		complete
	GO:0004140	dephospho-CoA kinase activity	PMID:11292795	IDA: Inferred from Direct Assay		F	assay of purified recombinant CoaE protein (Table 2 and accompanying text).	complete
	GO:0005829	cytosol	PMID:26602691	IEA: Inferred from Electronic Annotation		C	From EcoCyc_25.5	complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	References	Evidence
Protein	dps	PMID:19402753	LCMS(ID Probability):99.6
Protein	speD	PMID:19402753	LCMS(ID Probability):99.6
edit table

</protect>

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source	Notes
edit table

Notes

Structure and Physical Properties

[back to top]

<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MRYIVALTGG IGSGKSTVAN AFADLGINVI DADIIARQVV EPGAPALHAI ADHFGANMIA ADGTLQRRAL RERIFANPEE KNWLNALLHP LIQQETQHQI QQATSPYVLW VVPLLVENSL YKKANRVLVV DVSPETQLKR TMQRDDVTRE HVEQILAAQA TREARLAVAD DVIDNNGAPD AIASDVARLH AHYLQLASQF VSQEKP
Length	206
Mol. Wt	22.621 kDa
pI	6.2 (calculated)
Extinction coefficient	16,960 (calc based on 4 Y, 2 W, and 0 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
Domain	3..181	PF01121 Dephospho-CoA kinase		PMID:19920124
edit table

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=coaE taxon=562,83333 </beststructure>

Models

View models at:

edit table

</protect>

Structure figures

</protect>

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16128096	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:949060	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0000357	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P0A6I9	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:EG12312	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG12312	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:949060	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120002189	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB2218	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Reference(s)
Protein	E. coli K-12 MG1655	283	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
Protein	E. coli K-12 MG1655	133	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
Protein	E. coli K-12 MG1655	141	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
yacG
edit table

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<protect><gbrowseImage> name=NC_000913:113199..113239 source=MG1655 flip=1 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b0103 (EcoliWiki Page)	NCBI GEO profiles for coaE
microarray	GenExpDB:b0103 (EcoliWiki Page)	Summary of data for coaE from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
	GFP Fusion	Intergenic region (113151..113517) fused to gfpmut2.	OpenBioSystems	GFP fusion described in Zaslaver, et al. Plate:109-AZ06; Well:A1^[10]
edit table

Notes

Accessions Related to coaE Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG12312	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB2218	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b0103
EcoGene	EcoGene:EG12312	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120002189	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0000357	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Anopheles gambiae	ENSANGP00000017632 (score: 1.000; bootstrap: 87%)	From Inparanoid:20070104
Apis mellifera	ENSAPMP00000025726 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Arabidopsis thaliana	AT2G27490 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Bos taurus	ENSBTAP00000007945 (score: 1.000; bootstrap: 94%)	From Inparanoid:20070104
Caenorhabditis briggsae	WBGene00031493 (score: 1.000; bootstrap: 86%)	From Inparanoid:20070104
Caenorhabditis elegans	WBGene00011500 (score: 1.000; bootstrap: 90%)	From Inparanoid:20070104
Canis familiaris	ENSCAFP00000022023 (score: 1.000; bootstrap: 100%) ENSCAFP00000020537 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Ciona intestinalis	ENSCINP00000015584 (score: 1.000; bootstrap: 92%)	From Inparanoid:20070104
Danio rerio	ZDB-GENE-040912-137 (score: 1.000; bootstrap: 100%) ZDB-CDNA-040912-139 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Dictyostelium discoideum	DDB0231517 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Drosophila melanogaster	FBgn0037469 (score: 1.000; bootstrap: 74%)	From Inparanoid:20070104
Drosophila pseudoobscura	GA15141-PA (score: 1.000; bootstrap: 65%)	From Inparanoid:20070104
Gallus gallus	ENSGALP00000001281 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Homo sapiens	ENSP00000341504 (score: 1.000; bootstrap: 95%)	From Inparanoid:20070104
Macaca mulatta	ENSMMUP00000005435 (score: 1.000; bootstrap: 83%)	From Inparanoid:20070104
Monodelphis domestica	ENSMODP00000014067 (score: 1.000; bootstrap: 98%)	From Inparanoid:20070104
Mus musculus	MGI:1915337 (score: 1.000; bootstrap: 95%)	From Inparanoid:20070104
Pan troglodytes	ENSPTRP00000046355 (score: 1.000; bootstrap: 72%)	From Inparanoid:20070104
Rattus norvegicus	ENSRNOP00000037891 (score: 1.000; bootstrap: 96%)	From Inparanoid:20070104
Saccharomyces cerevisiae	YDR196C (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Schizosaccharomyces pombe	SPCC14G101 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Takifugu rubripes	NEWSINFRUP00000164207 (score: 1.000; bootstrap: 99%)	From Inparanoid:20070104
Tetraodon nigroviridis	GSTENP00019537001 (score: 1.000; bootstrap: 100%) GSTENP00008650001 (score: 0.425)	From Inparanoid:20070104
Xenopus tropicalis	ENSXETP00000006917 (score: 1.000; bootstrap: 93%)	From Inparanoid:20070104
Shigella flexneri	YACE	From SHIGELLACYC
E. coli O157	YACE	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Pfam (EcoliWiki Page)	PF01121 Dephospho-CoA kinase
Superfamily (EcoliWiki Page)	SUPERFAMILY:52540
Panther (EcoliWiki Page)	PTHR10695:SF11
EcoCyc	EcoCyc:EG12312	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG12312	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120002189	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB2218	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0000357	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.00 ^1.01 ^1.02 ^1.03 ^1.04 ^1.05 ^1.06 ^1.07 ^1.08 ^1.09 ^1.10 ^1.11 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.0 ^2.1 ^2.2 ^2.3 ^2.4 ^2.5 ^2.6 ^2.7 ^2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.0 ^3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 ^4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
↑ Yamamoto, N et al. (2009) Update on the Keio collection of Escherichia coli single-gene deletion mutants. Mol. Syst. Biol. 5 335 PubMed
↑ ^7.0 ^7.1 CGSC: The Coli Genetics Stock Center
↑ ^8.0 ^8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
↑ Mishra, P et al. (2001) Identification of yacE (coaE) as the structural gene for dephosphocoenzyme A kinase in Escherichia coli K-12. J. Bacteriol. 183 2774-8 PubMed
↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed

coaE:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to coaE Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search