bamA:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
bamA |
|---|---|
| Mnemonic |
Beta-barrel assembly machine |
| Synonyms |
ECK0176, b0177, JW0172, up05, ecfK, yzzN, yzzY, omp85(N.m.), bamA, yaeT[1][2][3], omp85, yaeT |
| edit table |
</protect>
Notes
A consensus has been reached for renaming the genes that encode components of the outer membrane β-barrel assembly machine, (formerly known as the YaeT complex of E. coli or the Omp85 complex of N. meningitidis). The new designation for this multi-component structure is the Bam complex (for beta-barrel assembly machine).
The Bam complex in E. coli consists of BamA (YaeT), BamB (YfgL), BamC (NlpB), BamD (YfiO), and BamE (SmpA). Letters have been assigned on the basis of molecular weight, from highest to lowest [3].
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
4.27 minutes |
MG1655: 197928..200360 |
||
|
NC_012967: 200770..203202 |
||||
|
NC_012759: 197927..200359 |
||||
|
W3110 |
|
W3110: 197928..200360 |
||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
197988 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
yaeT6 |
in-frame insertion of Gln–Lys after amino acid 218 of YaeT (BamA) |
Sensitivity to |
Rifampicin, Erythromycin, Novobiocin, Bacitracin |
Suppressor of imp4213 sensitivity to deoxycholate and chenodeoxycholate | |||
| edit table |
<protect></protect>
Notes
yaeT6 carries a 6-bp in-frame insertion (agaaac) between codons 218 and 219 of yaeT. At the protein level, the suppressor mutation results in an in-frame insertion of Gln–Lys after amino acid 218 of YaeT. The yaeT6 mutation was isolated as a suppressor of the imp4213 allele of lptD.[5]
The mutant allele bamA66 is a deletion of the R64 codon of bamA. The mutant protein is referred to as BamA(delR64). The bamA66 mutation was isolated as a suppressor that conferred increased resistance to bacitracin of a strain carrying the imp208 allele of lptD. In an lptD+ background, bamA66 displays a slight sensitivity to vancomycin and rifampin and causes a moderate reduction (20–30%) in OMP levels, but is synthetically lethal with the depletion of BamB, conditionally lethal in the absence of DegP or SurA; i.e. no growth at or above 37°C and 40°C respectively.[6]
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0172 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGCGATGAAAAAGTTGCTCAT Primer 2:CCCCAGGTTTTACCGATGTTAAA | |
|
Linked marker |
est. P1 cotransduction: 10% [9] | ||
|
Linked marker |
est. P1 cotransduction: 25% [9] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed
- ↑ 5.0 5.1 Ruiz, N et al. (2006) Probing the barrier function of the outer membrane with chemical conditionality. ACS Chem. Biol. 1 385-95 PubMed
- ↑ Bennion, D et al. (2010) Dissection of β-barrel outer membrane protein assembly pathways through characterizing BamA POTRA 1 mutants of Escherichia coli. Mol. Microbiol. 77 1153-71 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 8.0 8.1 CGSC: The Coli Genetics Stock Center
- ↑ 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
