aspC:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
aspC |
|---|---|
| Mnemonic |
Aspartate |
| Synonyms |
ECK0919, b0928, JW0911[1], JW0911 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
21.2 minutes |
MG1655: 984932..983742 |
||
|
NC_012967: 1002801..1001611 |
||||
|
NC_012759: 886710..887900 |
||||
|
W3110 |
|
W3110: 986131..984941 |
||
|
DH10B: 1038860..1037670 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
983742 |
Edman degradation |
PMID:387032[2] |
| |
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
aspCH133N |
H133N |
Auxotrophies |
Decreases to 60% in maximum rate of the overall reactions in both directions |
seeded from UniProt:P00509 | |||
|
aspCR374F,Y |
R374F,Y |
Auxotrophies |
Second-order rate constants are reduced by >5 orders of magnitude |
seeded from UniProt:P00509 | |||
|
aspCH133A |
H133A |
Auxotrophies |
Slight increase in maximum velocity of the overall transamination reaction between aspartate and 2-oxoglutarate |
seeded from UniProt:P00509 | |||
|
aspCY65F,S |
Y65F,S |
Auxotrophies |
Slight changes in activity |
seeded from UniProt:P00509 | |||
|
ΔaspC (Keio:JW0911) |
deletion |
deletion |
Auxotrophies |
Still Asp+. Mutations in aspC, tyrB, and ilvE are required before E. coli K-12 becomes auxotrophic for aspartate.[7] |
|||
|
aspC::Tn5KAN-2 (FB20252) |
Insertion at nt 615 in Minus orientation |
Auxotrophies |
does not contain pKD46 | ||||
|
aspC13 |
Auxotrophies |
||||||
|
aspC25 |
Auxotrophies |
||||||
|
ΔaspC745::kan |
deletion |
deletion |
Auxotrophies |
| |||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0911 |
Plasmid clone |
Status:Clone OK Primer 1:GCCTTTGAGAACATTACCGCCGC Primer 2:CCCAGCACTGCCACAATCGCTTC | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
zca-1230::Tn10 |
Linked marker |
est. P1 cotransduction: 21% [13] | |
|
Linked marker |
est. P1 cotransduction: 51% [13] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Kagamiyama, H & Yagi, T (1979) Aspartate transaminase from E. coli: amino acid sequences of the NH2-terminal 33 residues and chymotryptic pyridoxyl tetrapeptide. Biochem. Biophys. Res. Commun. 89 1347-53 PubMed
- ↑ Kondo, K et al. (1987) Structural studies on aspartate aminotransferase from Escherichia coli. Covalent structure. J. Biol. Chem. 262 8648-57 PubMed
- ↑ Kondo, K et al. (1984) The complete amino acid sequence of aspartate aminotransferase from Escherichia coli: sequence comparison with pig isoenzymes. Biochem. Biophys. Res. Commun. 122 62-7 PubMed
- ↑ Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed
- ↑ Han, Q et al. (2001) Kynurenine aminotransferase and glutamine transaminase K of Escherichia coli: identity with aspartate aminotransferase. Biochem. J. 360 617-23 PubMed
- ↑ 7.0 7.1 Gelfand, DH & Steinberg, RA (1977) Escherichia coli mutants deficient in the aspartate and aromatic amino acid aminotransferases. J. Bacteriol. 130 429-40 PubMed
- ↑ 8.0 8.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 9.0 9.1 9.2 CGSC: The Coli Genetics Stock Center
- ↑ Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 12.0 12.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 13.0 13.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).